Transcript: Mouse XR_001782354.1

PREDICTED: Mus musculus expressed sequence AW554918 (AW554918), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
AW554918 (225289)
Length:
1909
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782354.1
NBCI Gene record:
AW554918 (225289)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252820 TCGAGAGCTGGTTGCCGATAA pLKO_005 1306 3UTR 100% 10.800 15.120 N AW554918 n/a
2 TRCN0000252819 GTCAGTACTGTGGTCATAAAT pLKO_005 942 3UTR 100% 15.000 10.500 N AW554918 n/a
3 TRCN0000267596 ACCAGGTCTCAGAATCGTTTA pLKO_005 723 3UTR 100% 10.800 7.560 N AW554918 n/a
4 TRCN0000252822 TAAGAACTCAAGCTATGTTTA pLKO_005 1281 3UTR 100% 13.200 7.920 N AW554918 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.