Transcript: Mouse XR_001783746.1

PREDICTED: Mus musculus tudor domain containing 5 (Tdrd5), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tdrd5 (214575)
Length:
5289
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783746.1
NBCI Gene record:
Tdrd5 (214575)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783746.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252467 CCTGCTCAGCAGCACTATTTA pLKO_005 4096 3UTR 100% 15.000 10.500 N Tdrd5 n/a
2 TRCN0000258230 CTACCCAGATTTCGGAAATAT pLKO_005 3682 3UTR 100% 15.000 10.500 N Tdrd5 n/a
3 TRCN0000267402 GCGAAGACACCCACGTTTAAT pLKO_005 2735 3UTR 100% 15.000 10.500 N Tdrd5 n/a
4 TRCN0000252468 TGGTCTCTGACCGGTACATTA pLKO_005 3546 3UTR 100% 13.200 9.240 N Tdrd5 n/a
5 TRCN0000252466 CTGACTACTTTGATGTGTAAG pLKO_005 5173 3UTR 100% 10.800 7.560 N Tdrd5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783746.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.