Transcript: Mouse XR_003952824.1

PREDICTED: Mus musculus pyridine nucleotide-disulphide oxidoreductase domain 2 (Pyroxd2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pyroxd2 (74580)
Length:
3181
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003952824.1
NBCI Gene record:
Pyroxd2 (74580)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003952824.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267123 CCCAGTCAACTACCGTCATAT pLKO_005 2560 3UTR 100% 13.200 18.480 N Pyroxd2 n/a
2 TRCN0000267125 CCTTCTGCTGGGCACAGATAT pLKO_005 762 3UTR 100% 13.200 9.240 N Pyroxd2 n/a
3 TRCN0000267124 CTCCTGTCACCAAGATCAATG pLKO_005 1484 3UTR 100% 10.800 7.560 N Pyroxd2 n/a
4 TRCN0000283444 CTGTCACGGAGGAGATCATTC pLKO_005 578 3UTR 100% 10.800 7.560 N Pyroxd2 n/a
5 TRCN0000267122 GATACGAGGAGTTCATGAAAC pLKO_005 851 3UTR 100% 10.800 7.560 N Pyroxd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003952824.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.