Transcript: Mouse XR_385396.3

PREDICTED: Mus musculus RIKEN cDNA 1700061G19 gene (1700061G19Rik), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
1700061G19Rik (78625)
Length:
2304
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385396.3
NBCI Gene record:
1700061G19Rik (78625)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385396.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268281 GGTCATTCTAGACAACGATTT pLKO_005 2173 3UTR 100% 10.800 15.120 N 1700061G19Rik n/a
2 TRCN0000268229 CAATGGGTGCCAAGATCATTA pLKO_005 2148 3UTR 100% 13.200 9.240 N 1700061G19Rik n/a
3 TRCN0000268231 TGGGTATCATGGGCATCAATT pLKO_005 791 3UTR 100% 13.200 9.240 N 1700061G19Rik n/a
4 TRCN0000268230 TGGTTGTCAGACGTCCTATAT pLKO_005 2060 3UTR 100% 13.200 9.240 N 1700061G19Rik n/a
5 TRCN0000283647 AGCATCTCAAGGCCATCATAC pLKO_005 992 3UTR 100% 10.800 7.560 N 1700061G19Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385396.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.