Transcript: Mouse XR_387044.2

PREDICTED: Mus musculus protocadherin 11 X-linked (Pcdh11x), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcdh11x (245578)
Length:
4853
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_387044.2
NBCI Gene record:
Pcdh11x (245578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_387044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253352 TCCGGAGAACTCGGCTATAAA pLKO_005 1160 3UTR 100% 15.000 21.000 N Pcdh11x n/a
2 TRCN0000253354 GACCTCAACTTGTCGCTTATT pLKO_005 852 3UTR 100% 13.200 18.480 N Pcdh11x n/a
3 TRCN0000253353 TCCCGATGATGACTCAATTAA pLKO_005 4747 3UTR 100% 15.000 12.000 N Pcdh11x n/a
4 TRCN0000253351 ACTGCTAGAGTAACCATAAAT pLKO_005 2682 3UTR 100% 15.000 10.500 N Pcdh11x n/a
5 TRCN0000265390 TGTTGCAATTGACGATGATAT pLKO_005 2810 3UTR 100% 13.200 9.240 N Pcdh11x n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_387044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.