Transcript: Human XR_946633.1

PREDICTED: Homo sapiens NBPF member 7 (NBPF7), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NBPF7 (343505)
Length:
2461
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_946633.1
NBCI Gene record:
NBPF7 (343505)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_946633.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247603 GAGGAAAGGGTTACGACTTCT pLKO_005 906 3UTR 100% 4.950 6.930 N NBPF7 n/a
2 TRCN0000247601 AGCCAGCGAACACTCCAATTC pLKO_005 1019 3UTR 100% 10.800 8.640 N NBPF7 n/a
3 TRCN0000247599 GTGAATCTTCTCAAGATGAAT pLKO_005 812 3UTR 100% 5.625 3.938 N NBPF7 n/a
4 TRCN0000247602 TGACCATGATGTGTCCCAATC pLKO_005 932 3UTR 100% 6.000 3.600 N NBPF7 n/a
5 TRCN0000352961 CTGAGGAGCTCAGGCAATATA pLKO_005 347 3UTR 100% 15.000 7.500 Y NBPF11 n/a
6 TRCN0000255811 GAGGAGCTCAGGCAATATAAA pLKO_005 349 3UTR 100% 15.000 7.500 Y NBPF15 n/a
7 TRCN0000242329 TGAGGAGCTCAGGCAATATAA pLKO_005 348 3UTR 100% 15.000 7.500 Y NBPF9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_946633.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.