Transcript: Human XR_951201.2

PREDICTED: Homo sapiens CECR2 histone acetyl-lysine reader (CECR2), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CECR2 (27443)
Length:
1931
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_951201.2
NBCI Gene record:
CECR2 (27443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_951201.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240765 AGAAACTGAATGGAGGTTTAT pLKO_005 1419 3UTR 100% 13.200 9.240 N CECR2 n/a
2 TRCN0000240762 CCCTAACTATTATCAGATTAT pLKO_005 1366 3UTR 100% 13.200 9.240 N CECR2 n/a
3 TRCN0000240763 ACTTCGAGATCGAGGAGTTAG pLKO_005 219 3UTR 100% 10.800 7.560 N CECR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_951201.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.