Construct: shRNA TRCN0000072225

Construct Description:

Construct Type:
shRNA
Other Identifiers:
lacZ_2083s1c1
DNA Barcode:
CTCTGGCTAACGGTACGCGTA

Original Target:

Taxon:
Control
Gene:
lacZ (lacZ)
Gene Description:
lacZ
Transcript:
Broad lacZ.1 (CURRENT)
Match location:
Position 2083 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072225)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL lacZ lacZ lacZ lacZ.1 100% CDS 2083 0.720 N/A
2 CONTROL LacZ LacZ Hahn Lab LacZ LacZ.1 89% CDS 2068 N/A N/A
3 mouse 102632 Acad11 acyl-Coenzyme A dehydrogena... NM_175324.3 85% CDS 2271 N/A N/A
4 mouse 102632708 Gm15523 predicted gene 15523 XR_001780679.1 85% 3UTR 1646 N/A N/A
5 mouse 102632708 Gm15523 predicted gene 15523 XR_381867.1 85% 3UTR 1800 N/A N/A
6 mouse 102632708 Gm15523 predicted gene 15523 XR_381868.1 85% 3UTR 1297 N/A N/A
7 mouse 102632708 Gm15523 predicted gene 15523 XR_872949.2 85% 3UTR 1116 N/A N/A
8 mouse 102632708 Gm15523 predicted gene 15523 XR_872950.2 85% 3UTR 1875 N/A N/A
9 mouse 102632708 Gm15523 predicted gene 15523 XR_872951.1 85% 3UTR 877 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CTCTGGCTAACGGTACGCGTA
Hairpin Sequence:
5'-CCGG-CTCTGGCTAACGGTACGCGTA-CTCGAG-TACGCGTACCGTTAGCCAGAG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCTCTGGCTAACGGTACGCGTACTCGAGTACGCGTACCGTTAGCCAGAGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACTCTGGCTAACGGTACGCGTACTCGAGTACGCGTACCGTTAGCCAGAG-3'

Other clones with same target sequence:

(none)