Construct: shRNA TRCN0000072234

Construct Description:

Construct Type:
shRNA
Other Identifiers:
lacZ_14s1c1
DNA Barcode:
CGGATTCTCTGGCCGTCGTAT

Original Target:

Original Target:

Taxon:
Control
Gene:
lacZ (lacZ)
Gene Description:
lacZ
Transcript:
Broad lacZ.1 (CURRENT)
Match location:
Position 14 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072234)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL lacZ lacZ lacZ lacZ.1 100% CDS 14 1.650 N/A
2 human 255725 OR52B2 olfactory receptor family 5... NM_001004052.1 85% CDS 433 N/A N/A
3 mouse 102632594 LOC102632594 uncharacterized LOC102632594 XR_001781181.1 85% 3UTR 3675 N/A N/A
4 mouse 102632594 LOC102632594 uncharacterized LOC102632594 XR_874396.2 85% 3UTR 3675 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGGATTCTCTGGCCGTCGTAT
Hairpin Sequence:
5'-CCGG-CGGATTCTCTGGCCGTCGTAT-CTCGAG-ATACGACGGCCAGAGAATCCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGGATTCTCTGGCCGTCGTATCTCGAGATACGACGGCCAGAGAATCCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGGATTCTCTGGCCGTCGTATCTCGAGATACGACGGCCAGAGAATCCG-3'

Other clones with same target sequence:

(none)