Construct: shRNA TRCN0000072253

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_754s1c1
DNA Barcode:
ACACTCGGATATTTGATATGT

Original Target:

Original Target:

Taxon:
Control
Gene:
LUCIFERASE (LUCIFERASE)
Gene Description:
promegaLuc
Transcript:
Broad promegaLuc.1 (CURRENT)
Match location:
Position 754 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072253)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL LUCIFERASE LUCIFERASE promegaLuc promegaLuc.1 100% CDS 754 5.625 N/A
2 CONTROL Luciferase Luciferase Hahn Lab Luciferase Luciferase.1 100% CDS 754 5.625 N/A
3 human 400673 VMAC vimentin-type intermediate ... NM_001017921.3 89% 3UTR 1053 N/A N/A
4 mouse 102635257 Gm32643 predicted gene, 32643 XR_001778727.1 89% 3UTR 2778 N/A N/A
5 mouse 102635257 Gm32643 predicted gene, 32643 XR_001778728.1 89% 3UTR 2751 N/A N/A
6 mouse 102635257 Gm32643 predicted gene, 32643 XR_001778729.1 89% 3UTR 2918 N/A N/A
7 mouse 102635257 Gm32643 predicted gene, 32643 XR_001778730.1 89% 3UTR 2828 N/A N/A
8 mouse 102635257 Gm32643 predicted gene, 32643 XR_001778731.1 89% 3UTR 2868 N/A N/A
9 mouse 102635257 Gm32643 predicted gene, 32643 XR_388237.3 89% 3UTR 6098 N/A N/A
10 mouse 102635257 Gm32643 predicted gene, 32643 XR_879382.1 89% 3UTR 2805 N/A N/A
11 mouse 102635257 Gm32643 predicted gene, 32643 XR_879383.1 89% 3UTR 2661 N/A N/A
12 mouse 102635257 Gm32643 predicted gene, 32643 XR_879384.2 89% 3UTR 5909 N/A N/A
13 mouse 102635257 Gm32643 predicted gene, 32643 XR_879385.2 89% 3UTR 5890 N/A N/A
14 mouse 102635257 Gm32643 predicted gene, 32643 XR_879386.2 89% 3UTR 5954 N/A N/A
15 mouse 102635257 Gm32643 predicted gene, 32643 XR_879387.2 89% 3UTR 6053 N/A N/A
16 mouse 102635257 Gm32643 predicted gene, 32643 XR_879388.1 89% 3UTR 2786 N/A N/A
17 mouse 102635257 Gm32643 predicted gene, 32643 XR_879389.1 89% 3UTR 2642 N/A N/A
18 mouse 102635257 Gm32643 predicted gene, 32643 XR_879390.2 89% 3UTR 5935 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACACTCGGATATTTGATATGT
Hairpin Sequence:
5'-CCGG-ACACTCGGATATTTGATATGT-CTCGAG-ACATATCAAATATCCGAGTGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACACTCGGATATTTGATATGTCTCGAGACATATCAAATATCCGAGTGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACACTCGGATATTTGATATGTCTCGAGACATATCAAATATCCGAGTGT-3'

Other clones with same target sequence:

  1. TRCN0000231732