Construct: shRNA TRCN0000072259

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_159s1c1
DNA Barcode:
CGCTGAGTACTTCGAAATGTC

Original Target:

Original Target:

Taxon:
Control
Gene:
LUCIFERASE (LUCIFERASE)
Gene Description:
promegaLuc
Transcript:
Broad promegaLuc.1 (CURRENT)
Match location:
Position 159 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072259)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL LUCIFERASE LUCIFERASE promegaLuc promegaLuc.1 100% CDS 159 4.950 N/A
2 CONTROL luc2 luc2 gi 115342883 bases 141-1793... luc2.1 89% CDS 159 N/A N/A
3 CONTROL Luciferase Luciferase Hahn Lab Luciferase Luciferase.1 100% CDS 159 4.950 N/A
Download CSV

Sequence Information

Target Sequence:
CGCTGAGTACTTCGAAATGTC
Hairpin Sequence:
5'-CCGG-CGCTGAGTACTTCGAAATGTC-CTCGAG-GACATTTCGAAGTACTCAGCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCG-3'

Other clones with same target sequence:

  1. TRCN0000231715