Construct: shRNA TRCN0000231686

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_190s21c1
DNA Barcode:
CAGTTCCAGTACGGCTCCAAG

Original Target:

Original Target:

Taxon:
Control
Gene:
RFP (RFP)
Gene Description:
RFP
Transcript:
Broad rfp.1 (CURRENT)
Match location:
Position 190 (CDS)

Vector Information:

Vector Backbone:
pLKO_TRC005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000231686)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL RFP RFP RFP rfp.1 100% CDS 190 1.350 N/A
2 mouse 75956 Srrm2 serine/arginine repetitive ... NM_175229.3 89% CDS 6930 N/A N/A
3 mouse 75956 Srrm2 serine/arginine repetitive ... XM_006525076.3 89% CDS 7867 N/A N/A
4 mouse 75956 Srrm2 serine/arginine repetitive ... XM_006525077.3 89% CDS 7200 N/A N/A
5 mouse 75956 Srrm2 serine/arginine repetitive ... XM_006525078.3 89% CDS 7867 N/A N/A
6 mouse 75956 Srrm2 serine/arginine repetitive ... XM_006525079.3 89% CDS 7867 N/A N/A
7 mouse 75956 Srrm2 serine/arginine repetitive ... XM_011246701.2 89% CDS 7867 N/A N/A
8 mouse 75956 Srrm2 serine/arginine repetitive ... XM_011246702.2 89% CDS 7867 N/A N/A
9 mouse 75956 Srrm2 serine/arginine repetitive ... XM_017317708.1 89% CDS 7867 N/A N/A
10 mouse 75956 Srrm2 serine/arginine repetitive ... XM_017317709.1 89% CDS 7867 N/A N/A
11 mouse 75956 Srrm2 serine/arginine repetitive ... XM_017317710.1 89% CDS 7867 N/A N/A
12 mouse 75956 Srrm2 serine/arginine repetitive ... XM_017317711.1 89% CDS 7867 N/A N/A
13 mouse 75956 Srrm2 serine/arginine repetitive ... XM_017317712.1 89% CDS 7867 N/A N/A
14 mouse 75956 Srrm2 serine/arginine repetitive ... XM_017317713.1 89% CDS 7867 N/A N/A
15 mouse 75956 Srrm2 serine/arginine repetitive ... XM_017317714.1 89% CDS 7867 N/A N/A
16 mouse 11789 Apc adenomatosis polyposis coli NM_007462.3 89% CDS 8594 N/A N/A
17 mouse 11789 Apc adenomatosis polyposis coli XM_006525529.3 89% CDS 8862 N/A N/A
18 mouse 11789 Apc adenomatosis polyposis coli XM_006525530.1 89% CDS 8648 N/A N/A
19 mouse 11789 Apc adenomatosis polyposis coli XM_006525531.1 89% CDS 8435 N/A N/A
20 mouse 11789 Apc adenomatosis polyposis coli XM_006525532.3 89% CDS 8808 N/A N/A
21 mouse 11789 Apc adenomatosis polyposis coli XM_006525533.2 89% CDS 8409 N/A N/A
22 mouse 11789 Apc adenomatosis polyposis coli XM_006525534.3 89% CDS 8757 N/A N/A
23 mouse 11789 Apc adenomatosis polyposis coli XM_006525535.1 89% CDS 8457 N/A N/A
24 mouse 11789 Apc adenomatosis polyposis coli XM_006525536.3 89% CDS 8453 N/A N/A
25 mouse 11789 Apc adenomatosis polyposis coli XM_006525538.3 89% CDS 8558 N/A N/A
26 mouse 11789 Apc adenomatosis polyposis coli XM_006525539.2 89% CDS 8291 N/A N/A
27 mouse 11789 Apc adenomatosis polyposis coli XM_017317804.1 89% CDS 8399 N/A N/A
28 mouse 102638159 Gm13790 predicted gene 13790 XR_387591.3 81% 3UTR 227 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CAGTTCCAGTACGGCTCCAAG
Hairpin Sequence:
5'-CCGG-CAGTTCCAGTACGGCTCCAAG-CTCGAG-CTTGGAGCCGTACTGGAACTG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCAGTTCCAGTACGGCTCCAAGCTCGAGCTTGGAGCCGTACTGGAACTGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACAGTTCCAGTACGGCTCCAAGCTCGAGCTTGGAGCCGTACTGGAACTG-3'

Other clones with same target sequence:

(none)