Transcript: rfp.1

Tsien lab RFP from Genbank

Taxon:
Control
Gene:
RFP (RFP)
Length:
678
CDS:
1..678

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to rfp.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072211 CTACACCATCGTGGAACAGTA pLKO.1 621 CDS 100% 4.950 RFP
2 TRCN0000231723 CTACACCATCGTGGAACAGTA pLKO_005 621 CDS 100% 4.950 RFP
3 TRCN0000072215 GTAATGCAGAAGAAGACCATG pLKO.1 403 CDS 100% 4.050 RFP
4 TRCN0000231696 GTAATGCAGAAGAAGACCATG pLKO_005 403 CDS 100% 4.050 RFP
5 TRCN0000072213 ACTACACCATCGTGGAACAGT pLKO.1 620 CDS 100% 3.000 RFP
6 TRCN0000231725 ACTACACCATCGTGGAACAGT pLKO_005 620 CDS 100% 3.000 RFP
7 TRCN0000072217 CAACGAGGACTACACCATCGT pLKO.1 612 CDS 100% 2.640 RFP
8 TRCN0000231692 CAACGAGGACTACACCATCGT pLKO_005 612 CDS 100% 2.640 RFP
9 TRCN0000072212 CCGTAATGCAGAAGAAGACCA pLKO.1 401 CDS 100% 2.640 RFP
10 TRCN0000231724 CCGTAATGCAGAAGAAGACCA pLKO_005 401 CDS 100% 2.640 RFP
11 TRCN0000072210 CGTAATGCAGAAGAAGACCAT pLKO.1 402 CDS 100% 2.640 RFP
12 TRCN0000231690 CGTAATGCAGAAGAAGACCAT pLKO_005 402 CDS 100% 2.640 RFP
13 TRCN0000072219 CTACAAGACCGACATCAAGCT pLKO.1 576 CDS 100% 2.640 RFP
14 TRCN0000231689 CTACAAGACCGACATCAAGCT pLKO_005 576 CDS 100% 2.640 RFP
15 TRCN0000072204 TCAGTTCCAGTACGGCTCCAA pLKO.1 189 CDS 100% 2.640 RFP
16 TRCN0000231701 TCAGTTCCAGTACGGCTCCAA pLKO_005 189 CDS 100% 2.640 RFP
17 TRCN0000072206 GTGGGAGCGCGTGATGAACTT pLKO.1 276 CDS 100% 1.650 RFP
18 TRCN0000231686 CAGTTCCAGTACGGCTCCAAG pLKO_005 190 CDS 100% 1.350 RFP
19 TRCN0000072218 GAACGGCCACGAGTTCGAGAT pLKO.1 66 CDS 100% 1.350 RFP
20 TRCN0000231691 GAACGGCCACGAGTTCGAGAT pLKO_005 66 CDS 100% 1.350 RFP
21 TRCN0000072203 CGCGTGATGAACTTCGAGGAC pLKO.1 283 CDS 100% 0.720 RFP
22 TRCN0000072209 CTCAGTTCCAGTACGGCTCCA pLKO.1 188 CDS 100% 0.720 RFP
23 TRCN0000231683 CTCAGTTCCAGTACGGCTCCA pLKO_005 188 CDS 100% 0.720 RFP
24 TRCN0000072221 TGCAGAAGAAGACCATGGGCT pLKO.1 407 CDS 100% 0.660 RFP
25 TRCN0000231687 TGCAGAAGAAGACCATGGGCT pLKO_005 407 CDS 100% 0.660 RFP
26 TRCN0000072216 CCACTACGACGCCGAGGTCAA pLKO.1 513 CDS 100% 0.000 RFP
27 TRCN0000231694 CCACTACGACGCCGAGGTCAA pLKO_005 513 CDS 100% 0.000 RFP
28 TRCN0000231688 CCTGCAGGACGGCGAGTTCAT pLKO_005 336 CDS 100% 0.000 RFP
29 TRCN0000231698 CGAGTTCGAGATCGAGGGCGA pLKO_005 75 CDS 100% 0.000 RFP
30 TRCN0000072205 GCTCCGTGAACGGCCACGAGT pLKO.1 59 CDS 100% 0.000 RFP
31 TRCN0000231703 GCTCCGTGAACGGCCACGAGT pLKO_005 59 CDS 100% 0.000 RFP
32 TRCN0000072208 GCTTCAAGTGGGAGCGCGTGA pLKO.1 269 CDS 100% 0.000 RFP
33 TRCN0000231682 GCTTCAAGTGGGAGCGCGTGA pLKO_005 269 CDS 100% 0.000 RFP
34 TRCN0000231684 GTACGGCTCCAAGGCCTACGT pLKO_005 198 CDS 100% 0.000 RFP
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript rfp.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.