Construct: shRNA TRCN0000231688

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_336s21c1
DNA Barcode:
CCTGCAGGACGGCGAGTTCAT

Original Target:

Original Target:

Taxon:
Control
Gene:
RFP (RFP)
Gene Description:
RFP
Transcript:
Broad rfp.1 (CURRENT)
Match location:
Position 336 (CDS)

Vector Information:

Vector Backbone:
pLKO_TRC005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000231688)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL RFP RFP RFP rfp.1 100% CDS 336 0.000 N/A
2 human 55083 KIF26B kinesin family member 26B NM_018012.3 89% CDS 2294 N/A N/A
3 human 55083 KIF26B kinesin family member 26B XM_017030182.1 89% CDS 2846 N/A N/A
4 human 55083 KIF26B kinesin family member 26B XM_017030183.1 89% CDS 1133 N/A N/A
5 human 729359 PLIN4 perilipin 4 NM_001080400.1 89% CDS 3597 N/A N/A
6 human 729359 PLIN4 perilipin 4 XM_006722866.2 89% CDS 5558 N/A N/A
7 human 729359 PLIN4 perilipin 4 XM_006722868.3 89% CDS 5554 N/A N/A
8 human 729359 PLIN4 perilipin 4 XM_011528233.2 89% CDS 5740 N/A N/A
9 human 729359 PLIN4 perilipin 4 XM_017027192.1 89% CDS 5743 N/A N/A
10 human 729359 PLIN4 perilipin 4 XM_017027193.1 89% CDS 5690 N/A N/A
11 human 729359 PLIN4 perilipin 4 XM_017027194.1 89% CDS 5725 N/A N/A
12 mouse 67224 Med29 mediator complex subunit 29 NM_026042.3 85% 3UTR 1681 N/A N/A
13 mouse 72045 Mfsd4b2 major facilitator superfami... NM_001163503.1 89% 5UTR 66 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCTGCAGGACGGCGAGTTCAT
Hairpin Sequence:
5'-CCGG-CCTGCAGGACGGCGAGTTCAT-CTCGAG-ATGAACTCGCCGTCCTGCAGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCTGCAGGACGGCGAGTTCATCTCGAGATGAACTCGCCGTCCTGCAGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCTGCAGGACGGCGAGTTCATCTCGAGATGAACTCGCCGTCCTGCAGG-3'

Other clones with same target sequence:

(none)