Construct: shRNA TRCN0000231698

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_75s21c1
DNA Barcode:
CGAGTTCGAGATCGAGGGCGA

Original Target:

Original Target:

Taxon:
Control
Gene:
RFP (RFP)
Gene Description:
RFP
Transcript:
Broad rfp.1 (CURRENT)
Match location:
Position 75 (CDS)

Vector Information:

Vector Backbone:
pLKO_TRC005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000231698)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL RFP RFP RFP rfp.1 100% CDS 75 0.000 N/A
2 human 92922 CCDC102A coiled-coil domain containi... NM_033212.3 89% 5UTR 181 N/A N/A
3 human 11095 ADAMTS8 ADAM metallopeptidase with ... NM_007037.5 89% CDS 938 N/A N/A
4 human 11095 ADAMTS8 ADAM metallopeptidase with ... XM_017017145.1 89% CDS 458 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGAGTTCGAGATCGAGGGCGA
Hairpin Sequence:
5'-CCGG-CGAGTTCGAGATCGAGGGCGA-CTCGAG-TCGCCCTCGATCTCGAACTCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGAGTTCGAGATCGAGGGCGACTCGAGTCGCCCTCGATCTCGAACTCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGAGTTCGAGATCGAGGGCGACTCGAGTCGCCCTCGATCTCGAACTCG-3'

Other clones with same target sequence:

(none)