Construct: shRNA TRCN0000231701

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_189s21c1
DNA Barcode:
TCAGTTCCAGTACGGCTCCAA

Original Target:

Original Target:

Taxon:
Control
Gene:
RFP (RFP)
Gene Description:
RFP
Transcript:
Broad rfp.1 (CURRENT)
Match location:
Position 189 (CDS)

Vector Information:

Vector Backbone:
pLKO_TRC005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000231701)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL RFP RFP RFP rfp.1 100% CDS 189 2.640 N/A
2 mouse 16948 Lox lysyl oxidase NM_001286181.1 85% CDS 717 N/A N/A
3 mouse 16948 Lox lysyl oxidase NM_001286182.1 85% CDS 674 N/A N/A
4 mouse 16948 Lox lysyl oxidase NM_010728.3 85% CDS 1094 N/A N/A
5 mouse 11789 Apc adenomatosis polyposis coli NM_007462.3 89% CDS 8593 N/A N/A
6 mouse 11789 Apc adenomatosis polyposis coli XM_006525529.3 89% CDS 8861 N/A N/A
7 mouse 11789 Apc adenomatosis polyposis coli XM_006525530.1 89% CDS 8647 N/A N/A
8 mouse 11789 Apc adenomatosis polyposis coli XM_006525531.1 89% CDS 8434 N/A N/A
9 mouse 11789 Apc adenomatosis polyposis coli XM_006525532.3 89% CDS 8807 N/A N/A
10 mouse 11789 Apc adenomatosis polyposis coli XM_006525533.2 89% CDS 8408 N/A N/A
11 mouse 11789 Apc adenomatosis polyposis coli XM_006525534.3 89% CDS 8756 N/A N/A
12 mouse 11789 Apc adenomatosis polyposis coli XM_006525535.1 89% CDS 8456 N/A N/A
13 mouse 11789 Apc adenomatosis polyposis coli XM_006525536.3 89% CDS 8452 N/A N/A
14 mouse 11789 Apc adenomatosis polyposis coli XM_006525538.3 89% CDS 8557 N/A N/A
15 mouse 11789 Apc adenomatosis polyposis coli XM_006525539.2 89% CDS 8290 N/A N/A
16 mouse 11789 Apc adenomatosis polyposis coli XM_017317804.1 89% CDS 8398 N/A N/A
17 mouse 102638159 Gm13790 predicted gene 13790 XR_387591.3 81% 3UTR 226 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TCAGTTCCAGTACGGCTCCAA
Hairpin Sequence:
5'-CCGG-TCAGTTCCAGTACGGCTCCAA-CTCGAG-TTGGAGCCGTACTGGAACTGA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTCAGTTCCAGTACGGCTCCAACTCGAGTTGGAGCCGTACTGGAACTGATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATCAGTTCCAGTACGGCTCCAACTCGAGTTGGAGCCGTACTGGAACTGA-3'

Other clones with same target sequence:

  1. TRCN0000072204