Construct: shRNA TRCN0000231745

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_128s21c1
DNA Barcode:
TGACCCTGAAGTTCATCTGCA

Original Target:

Original Target:

Taxon:
Control
Gene:
GFP (GFP)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 128 (CDS)

Vector Information:

Vector Backbone:
pLKO_TRC005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000231745)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL GFP GFP clonetechGfp clonetechGfp.1 100% CDS 128 2.640 N/A
2 CONTROL BFP BFP Hahn Lab BFP BFP.1 100% CDS 128 2.640 N/A
3 CONTROL eGFP eGFP Hahn Lab eGFP eGFP.1 100% CDS 128 2.640 N/A
4 human 124359 CDYL2 chromodomain Y-like 2 NM_152342.3 89% 3UTR 3551 N/A N/A
5 human 124359 CDYL2 chromodomain Y-like 2 XM_011522866.1 89% 3UTR 3563 N/A N/A
6 human 124359 CDYL2 chromodomain Y-like 2 XM_011522867.2 89% 3UTR 4106 N/A N/A
7 human 6744 SSFA2 sperm specific antigen 2 XM_011511702.2 90% CDS 617 N/A N/A
8 human 55356 SLC22A15 solute carrier family 22 me... NM_018420.2 89% CDS 1056 N/A N/A
9 human 55356 SLC22A15 solute carrier family 22 me... XM_005271004.3 89% CDS 1017 N/A N/A
10 human 55356 SLC22A15 solute carrier family 22 me... XR_001737288.1 89% 3UTR 979 N/A N/A
11 human 79895 ATP8B4 ATPase phospholipid transpo... NM_024837.3 89% CDS 3327 N/A N/A
12 human 79895 ATP8B4 ATPase phospholipid transpo... NR_073596.1 89% 3UTR 3226 N/A N/A
13 human 79895 ATP8B4 ATPase phospholipid transpo... NR_073597.1 89% 3UTR 3179 N/A N/A
14 human 79895 ATP8B4 ATPase phospholipid transpo... NR_073598.1 89% 3UTR 3434 N/A N/A
15 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522046.2 89% CDS 3716 N/A N/A
16 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522047.2 89% CDS 4241 N/A N/A
17 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522048.1 89% CDS 3514 N/A N/A
18 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522049.2 89% CDS 3624 N/A N/A
19 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522051.2 89% CDS 3551 N/A N/A
20 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522052.2 89% CDS 3609 N/A N/A
21 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522053.1 89% CDS 3390 N/A N/A
22 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522056.2 89% CDS 3776 N/A N/A
23 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522058.2 89% CDS 3985 N/A N/A
24 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522059.1 89% CDS 3006 N/A N/A
25 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522060.1 89% CDS 3241 N/A N/A
26 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522061.1 89% CDS 3156 N/A N/A
27 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522062.1 89% CDS 2995 N/A N/A
28 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522063.1 89% CDS 2977 N/A N/A
29 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522064.1 89% CDS 2678 N/A N/A
30 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522069.2 89% CDS 2499 N/A N/A
31 human 79895 ATP8B4 ATPase phospholipid transpo... XM_011522070.1 89% CDS 1919 N/A N/A
32 human 79895 ATP8B4 ATPase phospholipid transpo... XM_017022587.1 89% CDS 3692 N/A N/A
33 human 79895 ATP8B4 ATPase phospholipid transpo... XM_017022588.1 89% CDS 3617 N/A N/A
34 human 79895 ATP8B4 ATPase phospholipid transpo... XM_017022589.1 89% CDS 3587 N/A N/A
35 human 79895 ATP8B4 ATPase phospholipid transpo... XM_017022590.1 89% CDS 3528 N/A N/A
36 human 79895 ATP8B4 ATPase phospholipid transpo... XM_017022591.1 89% CDS 3475 N/A N/A
37 human 79895 ATP8B4 ATPase phospholipid transpo... XM_017022592.1 89% CDS 3538 N/A N/A
38 human 79895 ATP8B4 ATPase phospholipid transpo... XM_017022594.1 89% CDS 3036 N/A N/A
39 human 79895 ATP8B4 ATPase phospholipid transpo... XM_017022595.1 89% CDS 5041 N/A N/A
40 human 79895 ATP8B4 ATPase phospholipid transpo... XM_017022596.1 89% CDS 2669 N/A N/A
41 human 100996490 LINC01206 long intergenic non-protein... NR_104146.1 95% 3UTR 8567 N/A N/A
42 human 101928331 LOC101928331 uncharacterized LOC101928331 XR_001743994.1 86% 3UTR 10258 N/A N/A
43 human 101928331 LOC101928331 uncharacterized LOC101928331 XR_001743995.1 86% 3UTR 10461 N/A N/A
44 human 101928331 LOC101928331 uncharacterized LOC101928331 XR_001743996.1 86% 3UTR 10506 N/A N/A
45 human 101928331 LOC101928331 uncharacterized LOC101928331 XR_001743997.1 86% 3UTR 10154 N/A N/A
46 human 101928331 LOC101928331 uncharacterized LOC101928331 XR_001743998.1 86% 3UTR 7376 N/A N/A
47 human 101928331 LOC101928331 uncharacterized LOC101928331 XR_001743999.1 86% 3UTR 9476 N/A N/A
48 human 101928331 LOC101928331 uncharacterized LOC101928331 XR_001758016.1 86% 3UTR 10258 N/A N/A
49 human 101928331 LOC101928331 uncharacterized LOC101928331 XR_001758017.1 86% 3UTR 10461 N/A N/A
50 human 101928331 LOC101928331 uncharacterized LOC101928331 XR_001758018.1 86% 3UTR 10506 N/A N/A
51 human 101928331 LOC101928331 uncharacterized LOC101928331 XR_001758019.1 86% 3UTR 10154 N/A N/A
52 human 101928331 LOC101928331 uncharacterized LOC101928331 XR_001758020.1 86% 3UTR 7376 N/A N/A
53 human 101928331 LOC101928331 uncharacterized LOC101928331 XR_001758021.1 86% 3UTR 9476 N/A N/A
54 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001735733.1 89% 3UTR 34 N/A N/A
55 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001735734.1 89% 3UTR 34 N/A N/A
56 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001735735.1 89% 3UTR 34 N/A N/A
57 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001735736.1 89% 3UTR 34 N/A N/A
58 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001735737.1 89% 3UTR 34 N/A N/A
59 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001735738.1 89% 3UTR 34 N/A N/A
60 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001735739.1 89% 3UTR 34 N/A N/A
61 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001738537.1 89% 3UTR 34 N/A N/A
62 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001738538.1 89% 3UTR 34 N/A N/A
63 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001738539.1 89% 3UTR 34 N/A N/A
64 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001738540.1 89% 3UTR 34 N/A N/A
65 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001738541.1 89% 3UTR 34 N/A N/A
66 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001738542.1 89% 3UTR 34 N/A N/A
67 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001738543.1 89% 3UTR 34 N/A N/A
68 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001738544.1 89% 3UTR 34 N/A N/A
69 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_001738545.1 89% 3UTR 34 N/A N/A
70 human 105370525 LOC105370525 uncharacterized LOC105370525 XR_001750984.1 89% 3UTR 1525 N/A N/A
71 human 105370525 LOC105370525 uncharacterized LOC105370525 XR_001750985.1 89% 3UTR 3901 N/A N/A
72 human 105370525 LOC105370525 uncharacterized LOC105370525 XR_915680.2 89% 3UTR 3902 N/A N/A
73 human 105370525 LOC105370525 uncharacterized LOC105370525 XR_943924.2 89% 3UTR 3901 N/A N/A
74 human 107985676 LOC107985676 uncharacterized LOC107985676 XR_001736749.1 89% 3UTR 163 N/A N/A
75 human 107985676 LOC107985676 uncharacterized LOC107985676 XR_001755791.1 89% 3UTR 161 N/A N/A
76 mouse 108682 Gpt2 glutamic pyruvate transamin... NM_173866.3 89% CDS 869 N/A N/A
77 mouse 54613 St3gal6 ST3 beta-galactoside alpha-... XM_011245974.2 89% 5UTR 83 N/A N/A
78 mouse 70599 Ssfa2 sperm specific antigen 2 XM_006500165.3 90% CDS 83 N/A N/A
79 mouse 242126 Slc22a15 solute carrier family 22 (o... NM_001039371.2 89% CDS 1261 N/A N/A
80 mouse 242126 Slc22a15 solute carrier family 22 (o... XR_001783691.1 89% 3UTR 1343 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TGACCCTGAAGTTCATCTGCA
Hairpin Sequence:
5'-CCGG-TGACCCTGAAGTTCATCTGCA-CTCGAG-TGCAGATGAACTTCAGGGTCA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTGACCCTGAAGTTCATCTGCACTCGAGTGCAGATGAACTTCAGGGTCATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATGACCCTGAAGTTCATCTGCACTCGAGTGCAGATGAACTTCAGGGTCA-3'

Other clones with same target sequence:

  1. TRCN0000072199