Construct: shRNA TRCN0000231752

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_693s21c1
DNA Barcode:
TCTCGGCATGGACGAGCTGTA

Original Target:

Original Target:

Taxon:
Control
Gene:
GFP (GFP)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 693 (CDS)

Vector Information:

Vector Backbone:
pLKO_TRC005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000231752)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL GFP GFP clonetechGfp clonetechGfp.1 100% CDS 693 1.350 N/A
2 CONTROL BFP BFP Hahn Lab BFP BFP.1 100% CDS 693 1.350 N/A
3 CONTROL eGFP eGFP Hahn Lab eGFP eGFP.1 100% CDS 693 1.350 N/A
4 mouse 15370 Nr4a1 nuclear receptor subfamily ... NM_010444.2 85% CDS 643 N/A N/A
5 mouse 15370 Nr4a1 nuclear receptor subfamily ... XM_006520455.1 85% CDS 688 N/A N/A
6 mouse 15370 Nr4a1 nuclear receptor subfamily ... XM_006520456.1 85% CDS 775 N/A N/A
7 mouse 15370 Nr4a1 nuclear receptor subfamily ... XM_006520458.1 85% CDS 960 N/A N/A
8 mouse 15370 Nr4a1 nuclear receptor subfamily ... XM_006520459.3 85% CDS 1623 N/A N/A
9 mouse 15370 Nr4a1 nuclear receptor subfamily ... XM_017316436.1 85% CDS 1508 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TCTCGGCATGGACGAGCTGTA
Hairpin Sequence:
5'-CCGG-TCTCGGCATGGACGAGCTGTA-CTCGAG-TACAGCTCGTCCATGCCGAGA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTCTCGGCATGGACGAGCTGTACTCGAGTACAGCTCGTCCATGCCGAGATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATCTCGGCATGGACGAGCTGTACTCGAGTACAGCTCGTCCATGCCGAGA-3'

Other clones with same target sequence:

  1. TRCN0000072182