Transcript: Mouse XM_006527361.3

PREDICTED: Mus musculus protein prenyltransferase alpha subunit repeat containing 1 (Ptar1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptar1 (72351)
Length:
13911
CDS:
563..1801

Additional Resources:

NCBI RefSeq record:
XM_006527361.3
NBCI Gene record:
Ptar1 (72351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527361.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376246 CAGGTTTATTGATCAAGTATT pLKO_005 1741 CDS 100% 13.200 18.480 N Ptar1 n/a
2 TRCN0000421157 ACTCTAGCAAGCAAGGCTATT pLKO_005 1656 CDS 100% 10.800 15.120 N PTAR1 n/a
3 TRCN0000376244 TGGTGTGTCAAGTTCTTATTA pLKO_005 737 CDS 100% 15.000 12.000 N Ptar1 n/a
4 TRCN0000376245 CAAGCGTGTTCTCCCGTTATC pLKO_005 1900 3UTR 100% 10.800 8.640 N Ptar1 n/a
5 TRCN0000367159 GAGAGGACACAGCGGATAATA pLKO_005 1073 CDS 100% 15.000 10.500 N Ptar1 n/a
6 TRCN0000367158 TGGCACTTTAAGTCCAATTAA pLKO_005 904 CDS 100% 15.000 10.500 N Ptar1 n/a
7 TRCN0000367092 GATGAACTGTCTTCTACTAAA pLKO_005 1214 CDS 100% 13.200 9.240 N Ptar1 n/a
8 TRCN0000036388 CATAGATGAAATTGGCCTGAT pLKO.1 646 CDS 100% 4.050 2.835 N PTAR1 n/a
9 TRCN0000367088 TCTACCTTCAGCATCACTTAA pLKO_005 1506 CDS 100% 13.200 7.920 N Ptar1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527361.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.