Transcript: Mouse XM_011245614.2

PREDICTED: Mus musculus CUB and Sushi multiple domains 3 (Csmd3), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csmd3 (239420)
Length:
7987
CDS:
305..7909

Additional Resources:

NCBI RefSeq record:
XM_011245614.2
NBCI Gene record:
Csmd3 (239420)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087303 GCATAGCCAATTCGGTTAATA pLKO.1 957 CDS 100% 15.000 21.000 N LOC432952 n/a
2 TRCN0000251128 GCACGCGAAGATGCGCTAAAT pLKO_005 363 CDS 100% 13.200 18.480 N Csmd3 n/a
3 TRCN0000419650 CAGACTTGGAATGGATTATAA pLKO_005 5437 CDS 100% 15.000 10.500 N CSMD3 n/a
4 TRCN0000251127 GATCCTGGCACACCGTTATAT pLKO_005 2300 CDS 100% 15.000 10.500 N Csmd3 n/a
5 TRCN0000087306 GCAGAAGAACGAAATAGAATA pLKO.1 593 CDS 100% 13.200 9.240 N LOC432952 n/a
6 TRCN0000251130 GCGAACTGTACATGGGTAATA pLKO_005 569 CDS 100% 13.200 9.240 N Csmd3 n/a
7 TRCN0000087304 GCTCACGGATTTAAAGTATAT pLKO.1 791 CDS 100% 13.200 9.240 N LOC432952 n/a
8 TRCN0000150302 CCACCAATTATCAGCAACAAA pLKO.1 1244 CDS 100% 5.625 3.938 N CSMD3 n/a
9 TRCN0000087305 GCTACAGCTGTGTAACTGGAT pLKO.1 906 CDS 100% 2.640 1.848 N LOC432952 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.