Transcript: Mouse XM_017317708.1

PREDICTED: Mus musculus serine/arginine repetitive matrix 2 (Srrm2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Srrm2 (75956)
Length:
10320
CDS:
908..8968

Additional Resources:

NCBI RefSeq record:
XM_017317708.1
NBCI Gene record:
Srrm2 (75956)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317708.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348743 CAAGGTAGACTCTAGATTAAG pLKO_005 3700 CDS 100% 13.200 10.560 N Srrm2 n/a
2 TRCN0000123443 CCCAAACCATACAGCCTTGTT pLKO.1 1409 CDS 100% 4.950 3.960 N Srrm2 n/a
3 TRCN0000335767 CCCAAACCATACAGCCTTGTT pLKO_005 1409 CDS 100% 4.950 3.960 N Srrm2 n/a
4 TRCN0000348733 TCACACCTAGAGTACTATTAA pLKO_005 4401 CDS 100% 15.000 10.500 N Srrm2 n/a
5 TRCN0000123440 CCAGTTTATCTCCAGAACATA pLKO.1 4545 CDS 100% 5.625 3.938 N Srrm2 n/a
6 TRCN0000123439 CACCTCATACTCTGGAGACAT pLKO.1 9819 3UTR 100% 4.950 3.465 N Srrm2 n/a
7 TRCN0000335691 CACCTCATACTCTGGAGACAT pLKO_005 9819 3UTR 100% 4.950 3.465 N Srrm2 n/a
8 TRCN0000123441 CCCAGTTTATCTCCAGAACAT pLKO.1 4544 CDS 100% 4.950 3.465 N Srrm2 n/a
9 TRCN0000123442 CCCAAAGTGAAGACAGTGATA pLKO.1 3578 CDS 100% 4.950 2.970 N Srrm2 n/a
10 TRCN0000335768 CCCAAAGTGAAGACAGTGATA pLKO_005 3578 CDS 100% 4.950 2.970 N Srrm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317708.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.