GPP Web Portal - Clone Details

Construct: sgRNA BRDN0000561167

Construct Description:

Construct Type:: sgRNA
Other Identifiers:: n/a
DNA Barcode:: GGGCGAGGAGCTGTTCACCG

Original Target:

Taxon:: Control
Gene:: eGFP (eGFP)
Gene Description:: n/a
CRISPR Mechanism: CRISPRko

Vector Information:

Vector Backbone:: pXPR_003
Pol II Cassette 1:: EF1A-PuroR
Pol II Cassette 2:: n/a
Selection Marker:: PuroR
Visible Reporter:: n/a
Epitope Tag:: n/a

Additional Information:

Addgene ID:: 80034

Gene matches for this target sequence (CRISPRko, PAM=NGG, human):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000017.11	17	82484914	+	NARF	NNNCAAGGAGCTGTTCAACG	NGG	2	0.4667	Tier I
2	NC_000006.12	6	153002574	-	MTRF1L	NNNGGAGGAGCTGTTCACCC	NGG	2	0.2143	Tier I
3	NC_000019.10	19	16847031	+	SIN3B	NNNAGAGGAGGTGTTCACCG	NGG	2	0.2105	Tier I
4	NC_000011.10	11	34160947	-	ABTB2	NNNCGAGGAGCTGGTGACCG	NGG	2	0.0	Tier I
5	NC_000002.12	2	36766018	+	VIT	NNNCGAGGAGCTGTTCACTT	NGG	2	0.3231	Tier II
6	NC_000006.12	6	52987130	+	GSTA4	NNNAGAGGAGCTGTTCACCG	NGA	2	0.0585	Tier II
7	NC_000004.12	4	101693889	+	LOC107986297	NNNCGAGTAGCTGTTCACCA	NGG	2	0.5859	Tier III
8	NC_000002.12	2	36766018	+	LOC124905990	NNNCGAGGAGCTGTTCACTT	NGG	2	0.3231	Tier III

Download CSV

Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000071.6	5	35724046	-	Sh3tc1	NNNTGAGGAGCTGTTCACCA	NGG	2	0.75	Tier I
2	NC_000082.6	16	33290194	+	Snx4	NNNCGAGGAGCTGGCCACCG	NGG	2	0.0	Tier I
3	NC_000067.6	1	192388120	+	Kcnh1	NNNCCAGGAGCTGTTCACCA	NGG	2	0.7366	Tier II
4	NC_000067.6	1	192388140	+	Kcnh1	NNNCCAGGAGCTGTTCACCA	NGG	2	0.7366	Tier II
5	NC_000067.6	1	192388160	+	Kcnh1	NNNCCAGGAGCTGTTCACCA	NGG	2	0.7366	Tier II
6	NC_000067.6	1	192388180	+	Kcnh1	NNNCCAGGAGCTGTTCACCA	NGG	2	0.7366	Tier II
7	NC_000077.6	11	75679837	+	Crk	NNNGGAGGAGCTGCTCACCG	NGG	2	0.1429	Tier II
8	NC_000080.6	14	32460600	-	Chat	NNNGGAGGAGCTGTCCACCG	NGG	2	0.1364	Tier II
9	NC_000067.6	1	180387783	-	Itpkb	NNNCTAGGACCTGTTCACCG	NGG	2	0.12	Tier II
10	NC_000067.6	1	40290605	+	Il1r1	NNNCGAGGAGCTGTTCACAG	NTG	2	0.0167	Tier II
11	NC_000071.6	5	45207438	-	D5Ertd615e	NNNCCAGGAGCTGTTCACCT	NGG	2	0.55	Tier III
12	NC_000067.6	1	165046087	-	Gm51669	NNNCTAGGAGCTGTGCACCG	NGG	2	0.015	Tier III
13	NC_000068.7	2	38672331	+	Adgrd2-ps	NNNCTAGGAGCTGTTCACCG	NTG	2	0.0117	Tier III

Download CSV

Other clones with same target sequence:

(none)