GPP Web Portal - Clone Details

Construct: sgRNA BRDN0000562805

Construct Description:

Construct Type:: sgRNA
Other Identifiers:: n/a
DNA Barcode:: GGTGCCCATCCTGGTCGAGC

Original Target:

Taxon:: Control
Gene:: eGFP (eGFP)
Gene Description:: n/a
CRISPR Mechanism: CRISPRko

Vector Information:

Vector Backbone:: pXPR_003
Pol II Cassette 1:: EF1A-PuroR
Pol II Cassette 2:: n/a
Selection Marker:: PuroR
Visible Reporter:: n/a
Epitope Tag:: n/a

Additional Information:

Addgene ID:: 80035

Gene matches for this target sequence (CRISPRko, PAM=NGG, human):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000002.12	2	232485266	+	ECEL1	NNNGCCCATCCTGGTCAATC	NGG	2	0.6222	Tier I
2	NC_000005.10	5	138465754	-	EGR1	NNNGGCCATCCTGGACGAGC	NGG	2	0.3474	Tier I
3	NC_000011.10	11	118533032	-	TMEM25	NNNGCCCATCCTGGTCGATC	NAG	2	0.1728	Tier I
4	NC_000019.10	19	1119984	+	SBNO2	NNNGCCCATCTTGGTGGAGC	NGG	2	0.0473	Tier I
5	NC_000001.11	1	84843852	-	LPAR3	NNNGCCCATCCAGGTAGAGC	NGG	2	0.8	Tier II
6	NC_000006.12	6	79634950	+	SH3BGRL2	NNNGCCCATCCTGCTCAAGC	NGG	2	0.4	Tier II
7	NC_000015.10	15	72197167	-	GRAMD2A	NNNGCCCATCCCGGTCGGGC	NGG	2	0.3789	Tier II
8	NC_000024.10	Y	13237437	-	UTY	NNNGCCCATCCTGGCCAAGC	NGG	2	0.2545	Tier II
9	NC_000012.12	12	104736436	+	CHST11	NNNGCCCAGCCTGGCCGAGC	NGG	2	0.1688	Tier II
10	NC_000010.11	10	132915044	-	CFAP46	NNNGCCCAGCCTGGTCTAGC	NGG	2	0.1548	Tier II
11	NC_000012.12	12	47799804	-	HDAC7	NNNGCCCAGCCTGGTCCAGC	NGG	2	0.1457	Tier II
12	NC_000002.12	2	88078020	-	SMYD1	NNNGCCCATCCTGGTCGGGC	NTG	2	0.0156	Tier II
13	NC_000010.11	10	91601124	+	HECTD2-AS1	NNNGTCCATCCTGGTCAAGC	NGG	2	0.5939	Tier III
14	NC_000004.12	4	19442719	-	LINC02438	NNNGCCAATCCTGGCCGAGC	NGG	2	0.2045	Tier III
15	NC_000007.14	7	149825825	-	SSPOP	NNNGCCCATCCTGGACCAGC	NGG	2	0.1362	Tier III

Download CSV

Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000067.6	1	87153585	+	Ecel1	NNNGCCCATCCTGGTCAATC	NGG	2	0.6222	Tier I
2	NC_000086.7	X	13486129	+	Nyx	NNNGCGCATCCTGGGCGAGC	NGG	2	0.025	Tier I
3	NC_000071.6	5	48971549	+	Kcnip4	NNNGGCCATCCTGGTCTAGC	NGG	2	0.15	Tier II
4	NC_000081.6	15	84444988	-	Shisal1	NNNGCCCATCCTGGTAGAGG	NGG	2	0.0588	Tier II
5	NC_000070.6	4	103851977	-	Dab1	NNNGCCCATCCTGGGAGAGC	NGG	2	0.05	Tier II
6	NC_000075.6	9	98296680	+	Nmnat3	NNNACCCATCCTGGTCGAGC	NGC	2	0.02	Tier II
7	NC_000067.6	1	87153585	+	Gm33292	NNNGCCCATCCTGGTCAATC	NGG	2	0.6222	Tier III

Download CSV

Other clones with same target sequence:

(none)