GPP Web Portal - Clone Details

Construct: sgRNA BRDN0001144890

Construct Description:

Construct Type:: sgRNA
Other Identifiers:: n/a
DNA Barcode:: AAAGTCCGTGGACATGTGGT

Original Target:

Taxon:: Homo sapiens (human)
Gene:: CDKL5 (6792)
Gene Description:: n/a
CRISPR Mechanism: CRISPRko

Vector Information:

Vector Backbone:: pXPR_003
Pol II Cassette 1:: EF1A-PuroR
Pol II Cassette 2:: n/a
Selection Marker:: PuroR
Visible Reporter:: n/a
Epitope Tag:: n/a

Additional Information:

Addgene ID:: 77197

Gene matches for this target sequence (CRISPRko, PAM=NGG, human):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000023.11	X	18587983	+	CDKL5	NNNGTCCGTGGACATGTGGT	NGG	0	1.0	Tier I
2	NC_000001.11	1	1636774	-	CDK11B	NNNGGCCGTGGACATGTGGT	NAG	2	0.1659	Tier I
3	NC_000001.11	1	1703916	-	CDK11A	NNNGGCCGTGGACATGTGGT	NAG	2	0.1659	Tier I
4	NC_000013.11	13	20416215	-	CRYL1	NNNGTCAGTGAACATGTGGT	NGG	2	0.75	Tier II
5	NC_000003.12	3	10457486	+	ATP2B2	NNNATCAGTGGACATGTGGT	NGG	2	0.675	Tier II
6	NC_000001.11	1	51409923	+	EPS15	NNNGTCCTTGGACATGTGAT	NGG	2	0.4464	Tier II
7	NC_000007.14	7	151394729	-	WDR86	NNNGTCCGTGGGCTTGTGGT	NGG	2	0.3852	Tier II
8	NC_000007.14	7	1434372	+	MICALL2	NNNGTCCGGGGCCATGTGGT	NGG	2	0.1629	Tier II
9	NC_000014.9	14	104987006	+	CLBA1	NNNGTCCCTGGCCATGTGGT	NGG	2	0.1619	Tier II
10	NC_000020.11	20	63356997	-	CHRNA4	NNNGTCCATGGAGATGTGGT	NGG	2	0.1364	Tier II
11	NC_000001.11	1	20175731	-	PLA2G2C	NNNGTCGGTGGACATGTGGG	NGG	2	0.083	Tier II
12	NC_000016.10	16	50362550	-	BRD7	NNNGTCAGTGGACATGTGGT	NTG	2	0.0292	Tier II
13	NC_000003.12	3	46457185	+	LTF	NNNGTCCGTGGCCAGGTGGT	NGG	2	0.0132	Tier II
14	NC_000002.12	2	174658933	-	WIPF1	NNNGTCCGAGGACATCTGGT	NGG	2	0.0	Tier II
15	NC_000005.10	5	7142093	-	LINC02196	NNNGTCAGAGGACATGTGGT	NGG	2	0.6964	Tier III
16	NC_000015.10	15	20754901	-	NBEAP1	NNNGTCCGTGGAGAGGTGGT	NGG	2	0.0068	Tier III
17	NT_187382.1	15	51237	-	LOC102723461	NNNGTCCGTGGAGAGGTGGT	NGG	2	0.0068	Tier III

Download CSV

Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000081.6	15	82332449	+	Naga	NNNGTCCGTGGACATGAGGA	NGG	2	0.3	Tier I
2	NC_000086.7	X	160852302	-	Cdkl5	NNNGTCAGTGGACATGTGGT	NAG	2	0.1944	Tier I
3	NC_000080.6	14	23894460	-	Kcnma1	NNNGCCCGTGGGCATGTGGT	NGG	2	0.7222	Tier II
4	NC_000075.6	9	67501888	-	Tln2	NNNGTCCATGGACATGTGGG	NGG	2	0.1765	Tier II
5	NC_000083.6	17	47227232	+	Trerf1	NNNTTCCGTGGACATGTGGT	NTG	2	0.0142	Tier II

Download CSV

Other clones with same target sequence:

(none)