GPP Web Portal - Clone Details

Construct: sgRNA BRDN0001144932

Construct Description:

Construct Type:: sgRNA
Other Identifiers:: n/a
DNA Barcode:: CAGCACTAGCAGTGGCACGG

Original Target:

Taxon:: Homo sapiens (human)
Gene:: DGKA (1606)
Gene Description:: n/a
CRISPR Mechanism: CRISPRko

Vector Information:

Vector Backbone:: pXPR_003
Pol II Cassette 1:: EF1A-PuroR
Pol II Cassette 2:: n/a
Selection Marker:: PuroR
Visible Reporter:: n/a
Epitope Tag:: n/a

Additional Information:

Addgene ID:: 76608

Gene matches for this target sequence (CRISPRko, PAM=NGG, human):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000012.12	12	55939274	-	DGKA	NNNCACTAGCAGTGGCACGG	NGG	0	1.0	Tier I
2	NC_000003.12	3	134858363	+	EPHB1	NNNCACTGGCAGTGGCACGT	NGG	2	0.5133	Tier II
3	NC_000002.12	2	50416787	+	NRXN1	NNNCACTATCAGTGGCATGG	NGG	2	0.3429	Tier II
4	NC_000019.10	19	16385104	+	EPS15L1	NNNCACTAGCAGAGGCGCGG	NGG	2	0.1222	Tier II

Download CSV

Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000076.6	10	128733297	+	Dgka	NNNCACAAGCAGTGGCACTG	NGG	2	0.5833	Tier I
2	NC_000074.6	8	15900749	-	Csmd1	NNNCACCAGCAGTGGCTCGG	NGG	2	0.0917	Tier I
3	NC_000070.6	4	146562368	-	Zfp993	NNNCAAAAGCAGTGGCACGG	NGG	2	0.8125	Tier II
4	NC_000070.6	4	146747779	-	Zfp993	NNNCAAAAGCAGTGGCACGG	NGG	2	0.8125	Tier II
5	NC_000072.6	6	114150652	-	Slc6a11	NNNCACTGGCAGTGGAACGG	NGG	2	0.7333	Tier II
6	NC_000072.6	6	91031263	-	Nup210	NNNCAATAGCAGTGGCACTG	NGG	2	0.619	Tier II
7	NC_000081.6	15	71819010	+	Col22a1	NNNCATTAGCAGTGGCACTG	NGG	2	0.619	Tier II
8	NC_000074.6	8	122318951	-	Zfpm1	NNNCAGAAGCAGTGGCACGG	NGG	2	0.4375	Tier II
9	NC_000073.6	7	57073524	-	Gabrg3	NNNCACTATCAGTGGCACTG	NGG	2	0.3556	Tier II
10	NC_000071.6	5	30516427	+	Cib4	NNNCAGGAGCAGTGGCACGG	NGG	2	0.2941	Tier II
11	NC_000070.6	4	58169352	+	Svep1	NNNCACTTGCAGTGGCACTG	NGG	2	0.2857	Tier II
12	NC_000068.7	2	114148026	-	Aqr	NNNCACCAGCAGTGGCAGGG	NGG	2	0.0917	Tier II
13	NC_000070.6	4	129986208	-	Adgrb2	NNNCACTAGCCGTGGCGCGG	NGG	2	0.0706	Tier II
14	NC_000085.6	19	61030604	-	Grk5	NNNCACTAGCAGGGGCAGGG	NGG	2	0.0348	Tier II
15	NC_000080.6	14	101500989	+	Tbc1d4	NNNCACTAGCAGTGGCACCG	NGA	2	0.0311	Tier II
16	NC_000070.6	4	145727472	-	Vmn2r-ps15	NNNCAAAAGCAGTGGCACGG	NGG	2	0.8125	Tier III
17	NC_000070.6	4	146221929	-	Vmn2r-ps17	NNNCAAAAGCAGTGGCACGG	NGG	2	0.8125	Tier III
18	NC_000070.6	4	146221929	-	Gm13165	NNNCAAAAGCAGTGGCACGG	NGG	2	0.8125	Tier III
19	NC_000070.6	4	146562368	-	Vmn2r-ps16	NNNCAAAAGCAGTGGCACGG	NGG	2	0.8125	Tier III

Download CSV

Other clones with same target sequence:

(none)