Construct: sgRNA BRDN0001144957
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- AAAATGTGATTGGCCCCAAG
Original Target:
- Taxon:
- Homo sapiens (human)
- Gene:
- ABCC1 (4363)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000016.10 | 16 | 16086971 | + | ABCC1 | NNNATGTGATTGGCCCCAAG | NGG | 0 | 1.0 | Tier I |
| 2 | NC_000009.12 | 9 | 27380210 | - | MOB3B | NNNTTGTGATTGGTCCCAAG | NGG | 2 | 0.4667 | Tier II |
| 3 | NC_000001.11 | 1 | 182484822 | + | RGSL1 | NNNTTGTGGTTGGCCCCAAG | NGG | 2 | 0.4242 | Tier II |
| 4 | NC_000003.12 | 3 | 4224690 | - | SUMF1 | NNNATCTGATTGGCCCCATG | NGG | 2 | 0.3671 | Tier II |
| 5 | NC_000009.12 | 9 | 114623583 | - | TMEM268 | NNNATGTGGGTGGCCCCAAG | NGG | 2 | 0.3333 | Tier II |
| 6 | NC_000006.12 | 6 | 166614085 | - | RPS6KA2 | NNNAGGTGATTGGCCCCTAG | NGG | 2 | 0.32 | Tier II |
| 7 | NC_000009.12 | 9 | 68417352 | + | PGM5 | NNNATGTGATTAGCCCCAAG | NAG | 2 | 0.242 | Tier II |
| 8 | NC_000001.11 | 1 | 224597479 | - | CNIH3 | NNNATGTGATTGGACCAAAG | NGG | 2 | 0.1633 | Tier II |
| 9 | NC_000008.11 | 8 | 64725118 | - | CYP7B1 | NNNATGTGATTGGACCAAAG | NGG | 2 | 0.1633 | Tier II |
| 10 | NC_000017.11 | 17 | 15534467 | - | TVP23C | NNNATGTGATTCTCCCCAAG | NGG | 2 | 0.1588 | Tier II |
| 11 | NC_000017.11 | 17 | 15534467 | - | TVP23C-CDRT4 | NNNATGTGATTCTCCCCAAG | NGG | 2 | 0.1588 | Tier II |
| 12 | NC_000002.12 | 2 | 185812490 | + | FSIP2 | NNNATGTGATTGGCACCAAT | NGG | 2 | 0.1556 | Tier II |
| 13 | NC_000010.11 | 10 | 133213469 | - | KNDC1 | NNNATGTGCTTGGCCCCCAG | NGG | 2 | 0.1088 | Tier II |
| 14 | NC_000016.10 | 16 | 6965723 | + | RBFOX1 | NNNATGTGATTGGCTCCAAA | NGG | 2 | 0.0625 | Tier II |
| 15 | NC_000003.12 | 3 | 156170080 | - | KCNAB1 | NNNATGTGCTTGGCCCCAAG | NGA | 2 | 0.0397 | Tier II |
| 16 | NC_000001.11 | 1 | 65385686 | + | DNAJC6 | NNNATGTGATGGGCCCCAAG | NGA | 2 | 0.0278 | Tier II |
| 17 | NC_000022.11 | 22 | 37760489 | + | TRIOBP | NNNATGTGATTGGCCCCAAG | NGC | 1 | 0.0222 | Tier II |
| 18 | NC_000007.14 | 7 | 122747733 | - | CADPS2 | NNNATGTGATTGGCCCCAAG | NGT | 1 | 0.0161 | Tier II |
| 19 | NC_000012.12 | 12 | 111128516 | - | CUX2 | NNNATGTGATTGGGCCCAAG | NAG | 2 | 0.0 | Tier II |
| 20 | NC_000009.12 | 9 | 8879358 | + | PTPRD | NNNATGTGATTGGGCCCAAT | NGG | 2 | 0.0 | Tier II |
| 21 | NC_000012.12 | 12 | 92711434 | - | PLEKHG7 | NNNATGTGATTGGGCTCAAG | NGG | 2 | 0.0 | Tier II |
| 22 | NC_000019.10 | 19 | 57197227 | - | ZNF264 | NNNATGTGATTGGGCTCAAG | NGG | 2 | 0.0 | Tier II |
| 23 | NC_000004.12 | 4 | 184264325 | + | LOC105377582 | NNNATGTGAATGGCCACAAG | NGG | 2 | 0.8571 | Tier III |
| 24 | NC_000010.11 | 10 | 133213469 | - | LOC105378573 | NNNATGTGCTTGGCCCCCAG | NGG | 2 | 0.1088 | Tier III |
| 25 | NC_000007.14 | 7 | 122747733 | - | LOC124901738 | NNNATGTGATTGGCCCCAAG | NGT | 1 | 0.0161 | Tier III |
| 26 | NC_000009.12 | 9 | 94168941 | - | MIRLET7A1HG | NNNATGTGATTAGCCCCAAG | NGT | 2 | 0.0151 | Tier III |
| 27 | NC_000012.12 | 12 | 92618048 | + | LOC105369905 | NNNATGTGATTGGGCCCAAG | NAG | 2 | 0.0 | Tier III |
| 28 | NC_000012.12 | 12 | 92618048 | + | LOC124902983 | NNNATGTGATTGGGCCCAAG | NAG | 2 | 0.0 | Tier III |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000084.6 | 18 | 62179486 | + | Adrb2 | NNNATGTGACTGGCCCCAAA | NGG | 2 | 0.5 | Tier I |
| 2 | NC_000070.6 | 4 | 141923937 | - | Fhad1 | NNNAGATGATTGGCCCCAAG | NGG | 2 | 0.64 | Tier II |
| 3 | NC_000080.6 | 14 | 61546884 | + | Spryd7 | NNNATGAGATTGGCCCCAAC | NGG | 2 | 0.375 | Tier II |
| 4 | NC_000068.7 | 2 | 7311728 | + | Celf2 | NNNATGTGATTCCCCCCAAG | NGG | 2 | 0.2229 | Tier II |
| 5 | NC_000076.6 | 10 | 75835641 | + | Gstt2 | NNNATGTGATTGGCCCCTAG | NAG | 2 | 0.1296 | Tier II |
| 6 | NC_000076.6 | 10 | 49562640 | + | Grik2 | NNNATGTGATTGGCCCAAAG | NGA | 2 | 0.0324 | Tier II |
| 7 | NC_000073.6 | 7 | 49110776 | - | Nav2 | NNNATGTGATTGGGCCCAAG | NAG | 2 | 0.0 | Tier II |
| 8 | NC_000070.6 | 4 | 141923937 | - | Gm35295 | NNNAGATGATTGGCCCCAAG | NGG | 2 | 0.64 | Tier III |
| 9 | NC_000070.6 | 4 | 98217059 | - | Gm12691 | NNNATGTGCTTGGTCCCAAG | NGG | 2 | 0.419 | Tier III |
| 10 | NC_000079.6 | 13 | 38557097 | - | Gm40922 | NNNATGTAATTGGCCCCCAG | NGG | 2 | 0.1905 | Tier III |
| 11 | NC_000075.6 | 9 | 25210821 | - | Gm29642 | NNNATGTGATTGGCACCCAG | NGG | 2 | 0.0423 | Tier III |
| 12 | NC_000073.6 | 7 | 49110776 | - | Gm32849 | NNNATGTGATTGGGCCCAAG | NAG | 2 | 0.0 | Tier III |