Construct: sgRNA BRDN0001145157
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- ACAAAGCGATTTAAAGCGAG
Original Target:
- Taxon:
-
Homo sapiens (human)
- Gene:
- HK1 (3098)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Vector Information:
- Vector Backbone:
- pXPR_003
- Pol II Cassette 1:
- EF1A-PuroR
- Pol II Cassette 2:
- n/a
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Additional Information:
- Addgene ID:
- 77643
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
| 1 |
NC_000010.11 |
10 |
69368571 |
+ |
HK1 |
NNNAAGCGATTTAAAGCGAG |
NGG |
0 |
1.0 |
Tier I |
| 2 |
NC_000010.11 |
10 |
93349990 |
+ |
MYOF |
NNNAAACGATTTAAAGAGAG |
NGG |
2 |
0.4667 |
Tier II |
| 3 |
NC_000002.12 |
2 |
40023818 |
- |
SLC8A1-AS1 |
NNNTAGCGATTTAAAGCAAG |
NGG |
2 |
0.4406 |
Tier III |
| 4 |
NC_000001.11 |
1 |
40437412 |
- |
ZFP69B-DT |
NNNAAGGGATTTAAAGCCAG |
NGG |
2 |
0.2241 |
Tier III |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
| 1 |
NC_000075.6 |
9 |
112249994 |
+ |
2900079G21Rik |
NNNAAGCTATTTAAAGGGAG |
NGG |
2 |
0.0368 |
Tier III |
Other clones with same target sequence:
(none)