Construct: sgRNA BRDN0001145243
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- ATGGGCAAGACCGCTCGCCG
Original Target:
- Taxon:
- Homo sapiens (human)
- Gene:
- TGFBR1 (7046)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000009.12 | 9 | 99142659 | - | TGFBR1 | NNNGGCAAGACCGCTCGCCG | NGG | 0 | 1.0 | Tier I |
| 2 | NC_000007.14 | 7 | 149765867 | + | ZNF467 | NNNGGAAAGGCCGCTCGCCG | NGG | 2 | 0.5159 | Tier I |
| 3 | NC_000011.10 | 11 | 65793335 | - | OVOL1 | NNNGGCAGGACCGCTCGCCG | NGG | 1 | 0.7333 | Tier II |
| 4 | NC_000011.10 | 11 | 65793335 | - | LOC124902693 | NNNGGCAGGACCGCTCGCCG | NGG | 1 | 0.7333 | Tier II |
| 5 | NC_000007.14 | 7 | 108295522 | + | NRCAM | NNNGGCAAGACAGCTCCCCG | NGG | 2 | 0.1681 | Tier II |
| 6 | NC_000009.12 | 9 | 129829392 | + | C9orf78 | NNNGGCAAGACTGCTCTCCG | NGG | 2 | 0.1346 | Tier II |
| 7 | NC_000010.11 | 10 | 3136377 | + | PFKP | NNNGGCAAGACCGCTCGCTG | NGC | 2 | 0.0103 | Tier II |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
No results found.