Construct: sgRNA BRDN0001145478
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- TCACCAACATCATTCCGGGG
Original Target:
- Taxon:
-
Homo sapiens (human)
- Gene:
- BRSK1 (84446)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Vector Information:
- Vector Backbone:
- pXPR_003
- Pol II Cassette 1:
- EF1A-PuroR
- Pol II Cassette 2:
- n/a
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Additional Information:
- Addgene ID:
- 77786
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
| 1 |
NC_000019.10 |
19 |
55303396 |
- |
BRSK1 |
NNNCCAACATCATTCCGGGG |
NGG |
0 |
1.0 |
Tier I |
| 2 |
NC_000001.11 |
1 |
110153929 |
- |
SLC6A17 |
NNNGCAACATCATTCAGGGG |
NGG |
2 |
0.5 |
Tier II |
| 3 |
NC_000015.10 |
15 |
41356187 |
- |
NUSAP1 |
NNNCCAACATCATTCCGAAG |
NGG |
2 |
0.4945 |
Tier II |
| 4 |
NC_000014.9 |
14 |
37074044 |
- |
SLC25A21 |
NNNCGAACATCATTCCTGGG |
NGG |
2 |
0.15 |
Tier II |
| 5 |
NC_000005.10 |
5 |
64722209 |
+ |
SREK1IP1 |
NNNCCAACATCATTTCTGGG |
NGG |
2 |
0.0167 |
Tier II |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
| 1 |
NC_000073.6 |
7 |
4706105 |
- |
Brsk1 |
NNNCCAACATCATTCCGAGG |
NGG |
1 |
0.6923 |
Tier I |
| 2 |
NC_000075.6 |
9 |
56794520 |
- |
Lingo1 |
NNNCCAACATCTTTCCGGGA |
NGG |
2 |
0.3125 |
Tier II |
Other clones with same target sequence:
(none)
