Construct: sgRNA BRDN0001145706
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- AGCATTGTTCCAATATCCCG
Original Target:
- Taxon:
- Homo sapiens (human)
- Gene:
- RP2 (6102)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000023.11 | X | 46854045 | + | RP2 | NNNATTGTTCCAATATCCCG | NGG | 0 | 1.0 | Tier I |
| 2 | NC_000018.10 | 18 | 26141515 | + | PSMA8 | NNNATTGTTACAATATCCCA | NGG | 2 | 0.8125 | Tier II |
| 3 | NC_000016.10 | 16 | 15021561 | + | PDXDC1 | NNNATTTTTTCAATATCCCG | NGG | 2 | 0.5378 | Tier II |
| 4 | NC_000012.12 | 12 | 44229555 | - | TMEM117 | NNNATTGTTCCAAAATCCCT | NGG | 2 | 0.4333 | Tier II |
| 5 | NC_000012.12 | 12 | 52098567 | - | SMIM41 | NNNATTGTTCCAATATCCAG | NGG | 1 | 0.4286 | Tier II |
| 6 | NC_000009.12 | 9 | 100007803 | + | ERP44 | NNNATAGTTGCAATATCCCG | NGG | 2 | 0.337 | Tier II |
| 7 | NC_000014.9 | 14 | 22010992 | + | TRA | NNNATTGTTCCAGTATCCCT | NGG | 2 | 0.4565 | Tier III |
| 8 | NC_000012.12 | 12 | 52098567 | - | OR7E47P | NNNATTGTTCCAATATCCAG | NGG | 1 | 0.4286 | Tier III |
| 9 | NC_000012.12 | 12 | 52098567 | - | LOC112268096 | NNNATTGTTCCAATATCCAG | NGG | 1 | 0.4286 | Tier III |
| 10 | NC_000001.11 | 1 | 237871815 | + | LOC100130331 | NNNATTGTTCCAATATCCCA | NAG | 2 | 0.2431 | Tier III |
| 11 | NC_000005.10 | 5 | 53859522 | - | ASS1P9 | NNNATTGTTCCCATTTCCCG | NGG | 2 | 0.0526 | Tier III |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
No results found.