GPP Web Portal - Clone Details

Construct: sgRNA BRDN0001145724

Construct Description:

Construct Type:: sgRNA
Other Identifiers:: n/a
DNA Barcode:: CAAGAACCAGATGACAAACG

Original Target:

Taxon:: Homo sapiens (human)
Gene:: PIK3R4 (30849)
Gene Description:: n/a
CRISPR Mechanism: CRISPRko

Vector Information:

Vector Backbone:: pXPR_003
Pol II Cassette 1:: EF1A-PuroR
Pol II Cassette 2:: n/a
Selection Marker:: PuroR
Visible Reporter:: n/a
Epitope Tag:: n/a

Additional Information:

Addgene ID:: 75593

Gene matches for this target sequence (CRISPRko, PAM=NGG, human):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000003.12	3	130708296	-	PIK3R4	NNNGAACCAGATGACAAACG	NGG	0	1.0	Tier I
2	NC_000012.12	12	5045139	-	KCNA5	NNNGAACCAGATGACGCACG	NGG	2	0.0339	Tier I
3	NC_000016.10	16	4853088	+	UBN1	NNNGAACCAGATCACAAACG	NTG	2	0.0164	Tier I
4	NC_000011.10	11	67959649	-	LOC112268076	NNNCAACCAGATGACAAACA	NGG	2	0.4963	Tier II
5	NC_000007.14	7	130280710	-	CPA2	NNNGAACCAGATGATAAACC	NGG	2	0.0286	Tier II
6	NC_000015.10	15	65054004	+	RASL12	NNNAAACCAGATGACAAACG	NGT	2	0.0145	Tier II
7	NC_000002.12	2	10146326	+	RRM2	NNNGAACCAGATGACCAATG	NGG	2	0.0	Tier II
8	NC_000008.11	8	7690655	-	LOC124901865	NNNAAACCAGATGACAAACA	NGG	2	0.8438	Tier III
9	NC_000008.11	8	8055447	+	LOC124901865	NNNAAACCAGATGACAAACA	NGG	2	0.8438	Tier III
10	NC_000014.9	14	81890194	+	LOC107984704	NNNAAACCAGATGACAAAAG	NGG	2	0.3857	Tier III

Download CSV

Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000074.6	8	84097755	-	Dcaf15	NNNGAACAGGATGACAAACG	NGG	2	0.4333	Tier I
2	NC_000086.7	X	12039056	-	Bcor	NNNGAACCAGATGACGAAAG	NGG	2	0.0824	Tier I
3	NC_000075.6	9	105667929	+	Pik3r4	NNNGAACCAGATGAGAAACG	NGG	1	0.05	Tier I
4	NC_000082.6	16	5055286	+	Ubn1	NNNGAACCAGATCACAAACG	NTG	2	0.0164	Tier I
5	NC_000067.6	1	133778523	+	Atp2b4	NNNGAAGCAGATGACAAACG	NGG	1	0.4706	Tier II
6	NC_000073.6	7	89817845	-	Me3	NNNGAACCAGATGACAAACC	NGG	1	0.4286	Tier II
7	NC_000068.7	2	109172300	+	Mettl15	NNNGACCCAGATGACAAACA	NGG	2	0.4261	Tier II
8	NC_000070.6	4	57040655	+	Epb41l4b	NNNGAACCAGATGTCAAACT	NGG	2	0.3733	Tier II
9	NC_000079.6	13	53195271	-	Ror2	NNNGAGCCAGATGACAACCG	NGG	2	0.1361	Tier II
10	NC_000069.6	3	136777230	-	Ppp3ca	NNNGAAACAGATGACAAAGG	NGG	2	0.0938	Tier II
11	NC_000068.7	2	154722778	+	Gm14216	NNNGAACCAGATTTCAAACG	NGG	2	0.16	Tier III
12	NC_000071.6	5	109692277	+	Vmn2r-ps23	NNNGAACCAGATGACAAACC	NTG	2	0.0167	Tier III

Download CSV

Other clones with same target sequence:

(none)