GPP Web Portal - Clone Details

Construct: sgRNA BRDN0001145956

Construct Description:

Construct Type:: sgRNA
Other Identifiers:: n/a
DNA Barcode:: CTCACCTGTAAACTCCCACG

Original Target:

Taxon:: Homo sapiens (human)
Gene:: NPR2 (4882)
Gene Description:: n/a
CRISPR Mechanism: CRISPRko

Vector Information:

Vector Backbone:: pXPR_003
Pol II Cassette 1:: EF1A-PuroR
Pol II Cassette 2:: n/a
Selection Marker:: PuroR
Visible Reporter:: n/a
Epitope Tag:: n/a

Additional Information:

Addgene ID:: 77752

Gene matches for this target sequence (CRISPRko, PAM=NGG, human):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000009.12	9	35802596	-	NPR2	NNNACCTGTAAACTCCCACG	NGG	0	1.0	Tier I
2	NC_000018.10	18	3712479	+	DLGAP1	NNNACCTGTTAACTCCCACA	NGG	2	0.8272	Tier II
3	NC_000007.14	7	152030181	+	GALNT11	NNNTTCTGTAAACTCCCACG	NGG	2	0.405	Tier II
4	NC_000005.10	5	167853453	-	TENM2	NNNCCCTGTAAGCTCCCACG	NGG	2	0.2549	Tier II
5	NC_000002.12	2	61080890	-	SANBR	NNNACCTGTCATCTCCCACG	NGG	2	0.1111	Tier II
6	NC_000020.11	20	18042381	-	OVOL2	NNNCCCTGTAACCTCCCACG	NGG	2	0.0929	Tier II
7	NC_000021.9	21	41764096	+	RIPK4	NNNACCTGTGAACTCCCAGG	NGG	2	0.0694	Tier II
8	NC_000011.10	11	35026619	+	LOC105376626	NNNACCTGCAAACACCCACG	NGG	2	0.5714	Tier III
9	NC_000022.11	22	27517797	-	LOC105372981	NNNACCTGTAAACACCCATG	NGG	2	0.2857	Tier III

Download CSV

Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000070.6	4	43644176	-	Npr2	NNNACTTGTAAGCTCCCACG	NGG	2	0.6706	Tier I
2	NC_000069.6	3	90458644	+	Npr1	NNNACCTGTAGGCTCCCACG	NGG	2	0.4694	Tier I
3	NC_000075.6	9	39910242	-	Olfr229	NNNAACTGTAAACTCCCACG	NTG	2	0.0223	Tier I
4	NC_000068.7	2	58494150	+	Acvr1	NNNACCTGCAAACTCACACG	NGG	2	0.9231	Tier II
5	NC_000070.6	4	57226375	+	Ptpn3	NNNGCCTGCAAACTCCCACG	NGG	2	0.5769	Tier II
6	NC_000074.6	8	88284674	+	Adcy7	NNNCCATGTAAACTCCCACG	NGG	2	0.3277	Tier II
7	NC_000077.6	11	115354880	-	Hid1	NNNACCTGTAACCTCCCACA	NGG	2	0.2467	Tier II
8	NC_000077.6	11	21094459	-	Peli1	NNNACCTGTAAACTCCCCCC	NGG	2	0.0816	Tier II
9	NC_000080.6	14	26852653	+	Dnah12	NNNACCTGTAAGCTGCCACG	NGG	2	0.0361	Tier II
10	NC_000079.6	13	44986577	+	Dtnbp1	NNNACCTGTGAACTGCCACG	NGG	2	0.0278	Tier II
11	NC_000080.6	14	9891206	+	Fhit	NNNACCTGTAAACTCCCTCG	NGC	2	0.0111	Tier II
12	NC_000068.7	2	167579252	+	Gm31619	NNNACCTGAAAACTCCAACG	NGG	2	0.4333	Tier III
13	NC_000068.7	2	167579252	+	Gm11476	NNNACCTGAAAACTCCAACG	NGG	2	0.4333	Tier III
14	NC_000078.6	12	27069586	+	Gm30515	NNNACCTGTAAACTAGCACG	NGG	2	0.0342	Tier III

Download CSV

Other clones with same target sequence:

(none)