Construct: sgRNA BRDN0001146527
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- TGTGCGCAGTAACCCCAACA
Original Target:
- Taxon:
-
Homo sapiens (human)
- Gene:
- PIK3CD (5293)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Vector Information:
- Vector Backbone:
- pXPR_003
- Pol II Cassette 1:
- EF1A-PuroR
- Pol II Cassette 2:
- n/a
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Additional Information:
- Addgene ID:
- 76164
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
| 1 |
NC_000001.11 |
1 |
9720163 |
+ |
PIK3CD |
NNNGCGCAGTAACCCCAACA |
NGG |
0 |
1.0 |
Tier I |
| 2 |
NC_000005.10 |
5 |
32734420 |
+ |
NPR3 |
NNNGCACAGTTACCCCAACA |
NGG |
2 |
0.3077 |
Tier II |
| 3 |
NC_000004.12 |
4 |
97984746 |
- |
STPG2 |
NNNGCGCAGCATCCCCAACA |
NGG |
2 |
0.1778 |
Tier II |
| 4 |
NC_000005.10 |
5 |
99523180 |
+ |
LOC100652833 |
NNNGAGTAGTAACCCCAACA |
NGG |
2 |
0.4643 |
Tier III |
| 5 |
NC_000005.10 |
5 |
99523999 |
+ |
LOC100652833 |
NNNGAGTAGTAACCCCAACA |
NGG |
2 |
0.4643 |
Tier III |
| 6 |
NC_000009.12 |
9 |
1356611 |
+ |
LOC102723803 |
NNNGCGCAGTCACCCCAACA |
NAG |
2 |
0.1037 |
Tier III |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
| 1 |
NC_000070.6 |
4 |
149656461 |
- |
Pik3cd |
NNNGCGCGGGAACCCCAACA |
NGG |
2 |
0.3667 |
Tier I |
Other clones with same target sequence:
(none)
