GPP Web Portal - Clone Details

Construct: sgRNA BRDN0001146636

Construct Description:

Construct Type:: sgRNA
Other Identifiers:: n/a
DNA Barcode:: GAAGAACACCAGCATCCGAG

Original Target:

Taxon:: Homo sapiens (human)
Gene:: CLK3 (1198)
Gene Description:: n/a
CRISPR Mechanism: CRISPRko

Vector Information:

Vector Backbone:: pXPR_003
Pol II Cassette 1:: EF1A-PuroR
Pol II Cassette 2:: n/a
Selection Marker:: PuroR
Visible Reporter:: n/a
Epitope Tag:: n/a

Additional Information:

Addgene ID:: 77285

Gene matches for this target sequence (CRISPRko, PAM=NGG, human):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000015.10	15	74627576	+	CLK3	NNNGAACACCAGCATCCGAG	NGG	0	1.0	Tier I
2	NC_000001.11	1	146018162	+	HJV	NNNGAACCCCAGCATCTGAG	NGG	2	0.2	Tier I
3	NC_000002.12	2	27257234	-	SLC30A3	NNNGAACACCAGCGTCCGGG	NGG	2	0.175	Tier I
4	NC_000023.11	X	48981786	+	GRIPAP1	NNNGAACACCATCATGCGAG	NGG	2	0.0592	Tier I
5	NC_000007.14	7	70782268	-	AUTS2	NNNGAAAACCAGCAACCGAG	NGG	2	0.4342	Tier II
6	NC_000002.12	2	109143038	-	RANBP2	NNNGAATACCAGCATCCCAG	NGG	2	0.3869	Tier II
7	NC_000002.12	2	109143038	-	SH3RF3	NNNGAATACCAGCATCCCAG	NGG	2	0.3869	Tier II
8	NC_000007.14	7	139566894	-	HIPK2	NNNGAACACCAGCACCAGAG	NGG	2	0.1273	Tier II
9	NC_000010.11	10	130039429	+	C10orf143	NNNGAGCACCAGCATCCGAG	NGC	2	0.0159	Tier II
10	NC_000009.12	9	96112647	+	LOC158434	NNNGAACACCAGCATCCCAG	NGG	1	0.4762	Tier III
11	NC_000001.11	1	247936527	-	CLK3P2	NNNGAGCACCAGCGTCCGAG	NGG	2	0.3333	Tier III
12	NC_000010.11	10	86534706	+	LOC105378408	NNNGAACTCCAGCATCTGAG	NGG	2	0.2	Tier III
13	NC_000013.11	13	110122293	-	LINC03082	NNNGAACACCAGCCTCAGAG	NGG	2	0.1	Tier III
14	NC_000013.11	13	110122293	-	LINC03032	NNNGAACACCAGCCTCAGAG	NGG	2	0.1	Tier III

Download CSV

Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000075.6	9	57753364	-	Clk3	NNNGAACACCAGCATCCGAG	NGG	0	1.0	Tier I
2	NC_000075.6	9	43792894	-	Nectin1	NNNGAACACCAGCTTCCCAG	NGG	2	0.254	Tier II
3	NC_000068.7	2	115894479	+	Meis2	NNNGAACCCCAGCATCTGAG	NGG	2	0.2	Tier II
4	NC_000071.6	5	27849166	-	Htr5a	NNNGAACTCCAGCATCAGAG	NGG	2	0.2	Tier II
5	NC_000073.6	7	30602822	+	Zbtb32	NNNGAACACCAGCATTCCAG	NGG	2	0.1465	Tier II
6	NC_000070.6	4	46919548	-	Gabbr2	NNNGAACACCAGCATCCCAG	NAG	2	0.1235	Tier II
7	NC_000070.6	4	106440351	-	Usp24	NNNGAACACCAGCATCCGAC	NAG	2	0.1111	Tier II
8	NC_000068.7	2	162405580	+	Ptprt	NNNCAACACCAGCAGCCGAG	NGG	2	0.0265	Tier II
9	NC_000075.6	9	119781490	-	Scn11a	NNNGAACCCCAGCATCGGAG	NGG	2	0.0252	Tier II

Download CSV

Other clones with same target sequence:

(none)