Construct: sgRNA BRDN0001146707
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- GCAATGTTCCTCTCGCCGCG
Original Target:
- Taxon:
- Homo sapiens (human)
- Gene:
- PRAG1 (157285)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000008.11 | 8 | 8377899 | + | PRAG1 | NNNATGTTCCTCTCGCCGCG | NGG | 0 | 1.0 | Tier I |
| 2 | NC_000006.12 | 6 | 138693051 | - | LOC124900217 | NNNAACTTCCTCTCGCCGCG | NGG | 2 | 0.3409 | Tier I |
| 3 | NC_000019.10 | 19 | 50565067 | - | LRRC4B | NNNGTGTTCCTCTCGCCACG | NGG | 2 | 0.4327 | Tier II |
| 4 | NC_000006.12 | 6 | 138693051 | - | NHSL1 | NNNAACTTCCTCTCGCCGCG | NGG | 2 | 0.3409 | Tier II |
| 5 | NC_000020.11 | 20 | 462211 | + | TBC1D20 | NNNCTGTTCCTCTCGCCGCC | NGG | 2 | 0.1513 | Tier II |
| 6 | NC_000009.12 | 9 | 34590612 | + | CNTFR | NNNATGTTCCTCGCGCCCCG | NGG | 2 | 0.1242 | Tier II |
| 7 | NC_000019.10 | 19 | 48630289 | + | DBP | NNNATGTTCCTCTCCCCGCG | NGT | 2 | 0.0044 | Tier II |
| 8 | NC_000019.10 | 19 | 48630289 | + | SPHK2 | NNNATGTTCCTCTCCCCGCG | NGT | 2 | 0.0044 | Tier II |
| 9 | NC_000006.12 | 6 | 138693051 | - | NHSL1-AS1 | NNNAACTTCCTCTCGCCGCG | NGG | 2 | 0.3409 | Tier III |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
No results found.