Construct: sgRNA BRDN0001146880
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- GGCACTGCACCCGTTCGCGG
Original Target:
- Taxon:
- Homo sapiens (human)
- Gene:
- STK11 (6794)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000019.10 | 19 | 1220597 | + | STK11 | NNNACTGCACCCGTTCGCGG | NGG | 0 | 1.0 | Tier I |
| 2 | NC_000017.11 | 17 | 29615811 | + | CORO6 | NNNCCTGCACCCGCTCGCGG | NGG | 2 | 0.1008 | Tier I |
| 3 | NC_000011.10 | 11 | 20474117 | + | PRMT3 | NNNACTGCACCCGTACGAGG | NGG | 2 | 0.3117 | Tier II |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
No results found.