Construct: sgRNA BRDN0001147000
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- TCACCTTGATCATCTGCGAG
Original Target:
- Taxon:
-
Homo sapiens (human)
- Gene:
- NEK6 (10783)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Vector Information:
- Vector Backbone:
- pXPR_003
- Pol II Cassette 1:
- EF1A-PuroR
- Pol II Cassette 2:
- n/a
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Additional Information:
- Addgene ID:
- 76256
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
| 1 |
NC_000009.12 |
9 |
124321557 |
- |
NEK6 |
NNNCCTTGATCATCTGCGAG |
NGG |
0 |
1.0 |
Tier I |
| 2 |
NC_000004.12 |
4 |
167234178 |
+ |
SPOCK3 |
NNNCCTTGAGCATCTGGGAG |
NGG |
2 |
0.0294 |
Tier I |
| 3 |
NC_000020.11 |
20 |
8529406 |
- |
PLCB1 |
NNNCCTTGAGCATATGCGAG |
NGG |
2 |
0.175 |
Tier II |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
| 1 |
NC_000068.7 |
2 |
38560979 |
- |
Nek6 |
NNNCCTTGATCATCTGTGAG |
NGG |
1 |
0.4667 |
Tier I |
| 2 |
NC_000076.6 |
10 |
123654130 |
+ |
Tafa2 |
NNNCCTTGAACATCTGCCAG |
NGG |
2 |
0.4082 |
Tier II |
| 3 |
NC_000073.6 |
7 |
100937886 |
+ |
P2ry6 |
NNNCCTTGATCATCTGAGAT |
NGG |
2 |
0.3267 |
Tier II |
| 4 |
NC_000084.6 |
18 |
24936505 |
+ |
Fhod3 |
NNNCCTTGAACATCTGGGAG |
NGG |
2 |
0.0504 |
Tier II |
| 5 |
NC_000076.6 |
10 |
105379899 |
- |
Tmtc2 |
NNNCTTTGATCATCTGGGAG |
NGG |
2 |
0.0374 |
Tier II |
Other clones with same target sequence:
(none)