Construct: sgRNA BRDN0001147383
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- GGAACGGTCATCCCACTCGG
Original Target:
- Taxon:
- Homo sapiens (human)
- Gene:
- PHKG2 (5261)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000016.10 | 16 | 30756486 | - | PHKG2 | NNNACGGTCATCCCACTCGG | NGG | 0 | 1.0 | Tier I |
| 2 | NC_000006.12 | 6 | 111873605 | - | LOC102724646 | NNNACGCTCAACCCACTCGG | NGG | 2 | 0.5156 | Tier III |
| 3 | NC_000007.14 | 7 | 77002748 | + | DTX2P1-UPK3BP1-PMS2P11 | NNNACGGTCACCCCACTGGG | NGG | 2 | 0.0889 | Tier III |
| 4 | NC_000007.14 | 7 | 77002748 | + | DTX2P1 | NNNACGGTCACCCCACTGGG | NGG | 2 | 0.0889 | Tier III |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
No results found.