GPP Web Portal - Clone Details

Construct: sgRNA BRDN0001147420

Construct Description:

Construct Type:: sgRNA
Other Identifiers:: n/a
DNA Barcode:: GACAGTCCAACATAAAGAGG

Original Target:

Taxon:: Homo sapiens (human)
Gene:: PIP5K1A (8394)
Gene Description:: n/a
CRISPR Mechanism: CRISPRko

Vector Information:

Vector Backbone:: pXPR_003
Pol II Cassette 1:: EF1A-PuroR
Pol II Cassette 2:: n/a
Selection Marker:: PuroR
Visible Reporter:: n/a
Epitope Tag:: n/a

Additional Information:

Addgene ID:: 77964

Gene matches for this target sequence (CRISPRko, PAM=NGG, human):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000001.11	1	151232663	+	PIP5K1A	NNNAGTCCAACATAAAGAGG	NGG	0	1.0	Tier I
2	NC_000005.10	5	53958292	+	ARL15	NNNAGAACAACATAAAGAGG	NGG	2	0.65	Tier II
3	NC_000001.11	1	111966796	+	KCND3	NNNAGTTCAACACAAAGAGG	NGG	2	0.6414	Tier II
4	NC_000011.10	11	123400549	+	GRAMD1B	NNNAGTCCAACATTAAGATG	NGG	2	0.3556	Tier II
5	NC_000004.12	4	88803005	-	FAM13A	NNNGGTCCAGCATAAAGAGG	NGG	2	0.3472	Tier II
6	NC_000020.11	20	53243590	+	TSHZ2	NNNAGTCCAACATGAAGAAG	NGG	2	0.3333	Tier II
7	NC_000016.10	16	56466442	-	OGFOD1	NNNAGTCCAACTTAAAGAGG	NGG	1	0.3333	Tier II
8	NC_000016.10	16	13056445	-	SHISA9	NNNATTCCAACATAAAGAGA	NGG	2	0.2813	Tier II
9	NC_000012.12	12	77748699	+	NAV3	NNNAGTCCAACTTAAAGAGT	NGG	2	0.2333	Tier II
10	NC_000004.12	4	185379134	-	LRP2BP	NNNAGTCCAACTTAAAGATG	NGG	2	0.2222	Tier II
11	NC_000006.12	6	154256162	+	IPCEF1	NNNAGTCCAACATCAAGATG	NGG	2	0.1429	Tier II
12	NC_000006.12	6	161717218	+	PRKN	NNNAGTCCAACATCGAGAGG	NGG	2	0.1393	Tier II
13	NC_000004.12	4	176134386	-	WDR17	NNNAGTCCAACATAAATAGC	NGG	2	0.1071	Tier II
14	NC_000023.11	X	54796238	-	ITIH6	NNNAGTCCAACAGAAAGAGG	NAG	2	0.0676	Tier II
15	NC_000019.10	19	34648835	-	SCGB2B2	NNNAGTCCAACACAAAGAGG	NGA	2	0.0548	Tier II
16	NC_000017.11	17	17930165	-	TOM1L2	NNNAGTCCAACAAAAAGAGG	NTG	2	0.027	Tier II
17	NC_000003.12	3	136907460	-	NCK1	NNNAGTCTAACATAAAGAGG	NGC	2	0.0194	Tier II
18	NC_000003.12	3	124409928	+	KALRN	NNNAGTCCAACAGAAAGAGG	NGA	2	0.0181	Tier II
19	NC_000003.12	3	2846587	-	CNTN4	NNNAGTCCAACATAAAGAGG	NAT	2	0.0	Tier II
20	NC_000006.12	6	7987096	+	PIP5K1P1	NNNACTCCAACATAAAGAGG	NGG	1	0.7857	Tier III
21	NC_000006.12	6	7987096	+	BLOC1S5-TXNDC5	NNNACTCCAACATAAAGAGG	NGG	1	0.7857	Tier III
22	NC_000018.10	18	5771007	-	MIR3976HG	NNNAGTCAAACACAAAGAGG	NGG	2	0.5132	Tier III
23	NC_000010.11	10	93960958	-	PIPSL	NNNAGTCCGACATAAAGAAG	NGG	2	0.4762	Tier III
24	NC_000007.14	7	159231982	+	PIP5K1P2	NNNAGTCCAACATAAACAGG	NGG	1	0.2353	Tier III
25	NC_000009.12	9	107801956	-	LOC105376208	NNNAGACCAACAGAAAGAGG	NGG	2	0.2261	Tier III
26	NC_000019.10	19	34648835	-	SCGB1B2P	NNNAGTCCAACACAAAGAGG	NGA	2	0.0548	Tier III
27	NC_000019.10	19	34648835	-	ZNF807P	NNNAGTCCAACACAAAGAGG	NGA	2	0.0548	Tier III
28	NC_000003.12	3	2846587	-	LOC105376926	NNNAGTCCAACATAAAGAGG	NAT	2	0.0	Tier III

Download CSV

Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000070.6	4	107081243	+	Cyb5rl	NNNAGTCCATCATACAGAGG	NGG	2	0.2406	Tier I
2	NC_000070.6	4	123105572	-	Bmp8b	NNNGGTCCAACATAAAGAGG	NGC	2	0.0139	Tier I
3	NC_000070.6	4	125679017	-	Grik3	NNNAGCCCGACATAAAGAGG	NGG	2	0.6061	Tier II
4	NC_000075.6	9	89948608	+	Rasgrf1	NNNAGACCAACAAAAAGAGG	NGG	2	0.6	Tier II
5	NC_000072.6	6	122581249	-	Apobec1	NNNAGTCCAACATAAAGTGA	NGG	2	0.4688	Tier II
6	NC_000074.6	8	127553199	+	Pard3	NNNAGTGAAACATAAAGAGG	NGG	2	0.3059	Tier II
7	NC_000073.6	7	143411341	+	Kcnq1	NNNACTCCAACAGAAAGAGG	NGG	2	0.205	Tier II
8	NC_000072.6	6	61836238	-	Ccser1	NNNAGTCCAACATCAAGAAG	NGG	2	0.1531	Tier II
9	NC_000085.6	19	25190432	-	Dock8	NNNAGTCCAGGATAAAGAGG	NGG	2	0.1389	Tier II
10	NC_000080.6	14	118999604	+	Uggt2	NNNAGTCCAACCTGAAGAGG	NGG	2	0.1228	Tier II
11	NC_000073.6	7	6787740	+	Usp29	NNNAGTCCAACTGAAAGAGG	NGG	2	0.087	Tier II
12	NC_000077.6	11	31933240	+	Cpeb4	NNNAGTCCAACAGAAAGAGG	NAG	2	0.0676	Tier II
13	NC_000081.6	15	7969829	+	Wdr70	NNNAGTCCATCATAATGAGG	NGG	2	0.0	Tier II
14	NC_000078.6	12	97362264	-	Gm40552	NNNAGTCCAAATTAAAGAGG	NGG	2	0.25	Tier III
15	NC_000072.6	6	51297598	-	Gm32479	NNNAGTCCAACATCAAGAGG	NGG	1	0.2143	Tier III
16	NC_000075.6	9	23112749	-	Gm36743	NNNAGTCCAACACAAGGAGG	NGG	2	0.1518	Tier III
17	NC_000080.6	14	23063470	+	Gm10248	NNNAGTCCAAGATAAAGAGG	NAG	2	0.0648	Tier III

Download CSV

Other clones with same target sequence:

(none)