Construct: sgRNA BRDN0001147509
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- CTCTATTGCAGTTAGCGGAG
Original Target:
- Taxon:
- Homo sapiens (human)
- Gene:
- ALK (238)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000002.12 | 2 | 29275222 | - | ALK | NNNTATTGCAGTTAGCGGAG | NGG | 0 | 1.0 | Tier I |
| 2 | NC_000001.11 | 1 | 64582256 | - | CACHD1 | NNNAATTGCAGTTAGGGGAG | NGG | 2 | 0.0733 | Tier I |
| 3 | NC_000020.11 | 20 | 33442493 | - | SNTA1 | NNNTACTGCTGTTAGCGGAG | NGG | 2 | 0.8021 | Tier II |
| 4 | NC_000021.9 | 21 | 32373496 | + | URB1 | NNNTATTGCAGTTAGCAGAG | NGT | 2 | 0.0151 | Tier II |
| 5 | NC_000002.12 | 2 | 217709306 | + | DIRC3 | NNNTATTGCAGTTAGAGCAG | NGG | 2 | 0.4762 | Tier III |
| 6 | NC_000016.10 | 16 | 67424771 | - | LOC124903702 | NNNTTTTGCAGTCAGCGGAG | NGG | 2 | 0.2871 | Tier III |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
No results found.