Construct: sgRNA BRDN0001147839
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- GCTTCTGGACGTCTTCACGC
Original Target:
- Taxon:
-
Homo sapiens (human)
- Gene:
- MAPK11 (5600)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Vector Information:
- Vector Backbone:
- pXPR_003
- Pol II Cassette 1:
- EF1A-PuroR
- Pol II Cassette 2:
- n/a
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Additional Information:
- Addgene ID:
- 77484
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
| 1 |
NC_000022.11 |
22 |
50267603 |
- |
MAPK11 |
NNNTCTGGACGTCTTCACGC |
NGG |
0 |
1.0 |
Tier I |
| 2 |
NC_000016.10 |
16 |
49620685 |
- |
ZNF423 |
NNNCCTGGACGTCCTCACGC |
NGG |
2 |
0.1849 |
Tier II |
| 3 |
NC_000002.12 |
2 |
20412302 |
+ |
LOC105373465 |
NNNTCTGGCCGTCTTCACGA |
NGG |
2 |
0.2857 |
Tier III |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
| 1 |
NC_000081.6 |
15 |
89146505 |
- |
Mapk11 |
NNNTTTGGACGTCTTCACGC |
NGG |
1 |
0.6364 |
Tier I |
| 2 |
NC_000077.6 |
11 |
116455357 |
+ |
Qrich2 |
NNNTCTGGACTTCTTCAGGC |
NGG |
2 |
0.0513 |
Tier I |
| 3 |
NC_000084.6 |
18 |
60606037 |
- |
Synpo |
NNNTCTGAACGTCTTCACAC |
NGG |
2 |
0.7143 |
Tier II |
| 4 |
NC_000085.6 |
19 |
43795746 |
+ |
Abcc2 |
NNNTCTGGATGTCTTCACGA |
NGG |
2 |
0.4706 |
Tier II |
| 5 |
NC_000067.6 |
1 |
159729556 |
+ |
Tnr |
NNNTCTGGACGTCTTCCTGC |
NGG |
2 |
0.1134 |
Tier II |
| 6 |
NC_000070.6 |
4 |
148061512 |
+ |
Gm13201 |
NNNCCTGGAAGTCTTCACGC |
NGG |
2 |
0.5608 |
Tier III |
Other clones with same target sequence:
(none)
