Construct: sgRNA BRDN0001148974
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- TGAATACAAGTGGTCAACAG
Original Target:
- Taxon:
- Homo sapiens (human)
- Gene:
- CPNE3 (8895)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000008.11 | 8 | 86528666 | + | CPNE3 | NNNATACAAGTGGTCAACAG | NGG | 0 | 1.0 | Tier I |
| 2 | NC_000002.12 | 2 | 171031260 | - | TLK1 | NNNATACAAATGGACAACAG | NGG | 2 | 0.5778 | Tier II |
| 3 | NC_000005.10 | 5 | 26953768 | - | CDH9 | NNNATTCAGGTGGTCAACAG | NGG | 2 | 0.4762 | Tier II |
| 4 | NC_000002.12 | 2 | 27298113 | - | TRIM54 | NNNATACAAGTGCTCAACAA | NGG | 2 | 0.3947 | Tier II |
| 5 | NC_000006.12 | 6 | 16316839 | + | ATXN1 | NNNGTACAAGTGGACAACAG | NGG | 2 | 0.3869 | Tier II |
| 6 | NC_000007.14 | 7 | 102297058 | + | SH2B2 | NNNATACCCGTGGTCAACAG | NGG | 2 | 0.2449 | Tier II |
| 7 | NC_000002.12 | 2 | 182843991 | - | FRZB | NNNATACAAGTGGTCAACAA | NAG | 2 | 0.2431 | Tier II |
| 8 | NC_000015.10 | 15 | 31745920 | + | OTUD7A | NNNATACAAATGGTCAACAG | NAG | 2 | 0.242 | Tier II |
| 9 | NC_000010.11 | 10 | 119928631 | - | SEC23IP | NNNATCCAAGTGTTCAACAG | NGG | 2 | 0.1364 | Tier II |
| 10 | NC_000001.11 | 1 | 103053702 | + | COL11A1 | NNNATACAAGTGGTCAGTAG | NGG | 2 | 0.1134 | Tier II |
| 11 | NC_000006.12 | 6 | 108500935 | - | AFG1L | NNNATACAAGTGGTCAACAA | NGA | 2 | 0.0651 | Tier II |
| 12 | NC_000006.12 | 6 | 35314546 | - | DEF6 | NNNATACAAATGGTCAACAG | NGA | 2 | 0.0648 | Tier II |
| 13 | NC_000019.10 | 19 | 55922667 | + | NLRP13 | NNNATACAATTGGTTAACAG | NGG | 2 | 0.0542 | Tier II |
| 14 | NC_000003.12 | 3 | 155134916 | - | MME | NNNATACAAGTGGTCAACAA | NTG | 2 | 0.0365 | Tier II |
| 15 | NC_000023.11 | X | 112197192 | + | RTL4 | NNNATACAAATGGTCAACAG | NTG | 2 | 0.0364 | Tier II |
| 16 | NC_000006.12 | 6 | 57519966 | - | PRIM2 | NNNATACAAGTGGTCAACAT | NTG | 2 | 0.0273 | Tier II |
| 17 | NC_000002.12 | 2 | 233781517 | - | MROH2A | NNNATACAAGTGGCCAACAG | NGA | 2 | 0.0198 | Tier II |
| 18 | NC_000022.11 | 22 | 45777467 | + | ATXN10 | NNNATACAAGTGGTAAACAG | NTG | 2 | 0.0087 | Tier II |
| 19 | NC_000003.12 | 3 | 37928511 | - | CTDSPL | NNNATACAAGTGGTCAACAG | NTA | 2 | 0.0 | Tier II |
| 20 | NC_000006.12 | 6 | 44441740 | - | CDC5L | NNNATACAAGTGGTCAACAG | NTA | 2 | 0.0 | Tier II |
| 21 | NC_000012.12 | 12 | 39680362 | + | REDIC1 | NNNATACAAGTGGTCAACAG | NTA | 2 | 0.0 | Tier II |
| 22 | NC_000012.12 | 12 | 86618063 | + | MGAT4C | NNNATACAAGTGGTCAACAG | NTA | 2 | 0.0 | Tier II |
| 23 | NC_000017.11 | 17 | 2943764 | + | RAP1GAP2 | NNNATACAAGTGGTCAACAG | NTA | 2 | 0.0 | Tier II |
| 24 | NC_000003.12 | 3 | 21091365 | + | LOC105376987 | NNNAGACAAATGGTCAACAG | NGG | 2 | 0.5973 | Tier III |
| 25 | NC_000003.12 | 3 | 135831903 | - | LOC105374124 | NNNATTGAAGTGGTCAACAG | NGG | 2 | 0.3361 | Tier III |
| 26 | NC_000007.14 | 7 | 94297292 | + | LOC112267858 | NNNATAAAAGTGGTCAACAC | NGG | 2 | 0.3214 | Tier III |
| 27 | NC_000006.12 | 6 | 155861660 | - | LOC101928923 | NNNATACAAGTGGCCAACAG | NCG | 2 | 0.0306 | Tier III |
| 28 | NC_000006.12 | 6 | 155861660 | - | LOC105378072 | NNNATACAAGTGGCCAACAG | NCG | 2 | 0.0306 | Tier III |
| 29 | NC_000003.12 | 3 | 91501366 | + | LOC101930420 | NNNATACAAGTGGTCAACAT | NTG | 2 | 0.0273 | Tier III |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000073.6 | 7 | 66262712 | - | Lrrk1 | NNNATGGAAGTGGTCAACAG | NGG | 2 | 0.3361 | Tier I |
| 2 | NC_000070.6 | 4 | 19555374 | - | Cpne3 | NNNATACGAGTGGTCACCAG | NGG | 2 | 0.1294 | Tier I |
| 3 | NC_000067.6 | 1 | 179503555 | - | Smyd3 | NNNATACAAGAGGTTAACAG | NGG | 2 | 0.05 | Tier II |
| 4 | NC_000072.6 | 6 | 22335499 | + | Fam3c | NNNATACAAGTGATCAACAG | NTG | 2 | 0.036 | Tier II |
| 5 | NC_000082.6 | 16 | 9858675 | - | Grin2a | NNNATACAAGTGGTCAGGAG | NGG | 2 | 0.0235 | Tier II |
| 6 | NC_000080.6 | 14 | 39208995 | + | Nrg3 | NNNATAAAAGTGGTCAACAG | NGT | 2 | 0.0121 | Tier II |
| 7 | NC_000071.6 | 5 | 123125565 | - | Rhof | NNNATACAAGTGGTAAACAG | NGT | 2 | 0.0036 | Tier II |
| 8 | NC_000070.6 | 4 | 139431302 | + | Ubr4 | NNNATACAAGTGGGCACCAG | NGG | 2 | 0.0 | Tier II |
| 9 | NC_000086.7 | X | 162080179 | + | Nhs | NNNATACAAGTGGGCAGCAG | NGG | 2 | 0.0 | Tier II |
| 10 | NC_000072.6 | 6 | 66198277 | - | Gm36408 | NNNATACAAATAGTCAACAG | NGG | 2 | 0.8711 | Tier III |
| 11 | NC_000073.6 | 7 | 66262712 | - | Gm33442 | NNNATGGAAGTGGTCAACAG | NGG | 2 | 0.3361 | Tier III |