Construct: sgRNA BRDN0001148979
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- GGGCTGTGCGGTGATTGACG
Original Target:
- Taxon:
- Homo sapiens (human)
- Gene:
- DCAKD (79877)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000017.11 | 17 | 45034798 | - | DCAKD | NNNCTGTGCGGTGATTGACG | NGG | 0 | 1.0 | Tier I |
| 2 | NC_000013.11 | 13 | 112796755 | + | ATP11A | NNNCTGTACGGAGATTGACG | NGG | 2 | 0.8 | Tier II |
| 3 | NC_000022.11 | 22 | 43297567 | + | SCUBE1 | NNNCTGTGCTGTGATTGACA | NGG | 2 | 0.7617 | Tier II |
| 4 | NC_000002.12 | 2 | 85255888 | + | TCF7L1 | NNNCTGTGCGGTGATTGACT | NGG | 1 | 0.7 | Tier II |
| 5 | NC_000001.11 | 1 | 10728661 | + | CASZ1 | NNNCTGAGGGGTGATTGACG | NGG | 2 | 0.5417 | Tier II |
| 6 | NC_000010.11 | 10 | 43263912 | - | RASGEF1A | NNNCTGTGCTGTGATGGACG | NGG | 2 | 0.2813 | Tier II |
| 7 | NC_000004.12 | 4 | 2287590 | + | ZFYVE28 | NNNCTCTGCGGTGACTGACG | NGG | 2 | 0.186 | Tier II |
| 8 | NC_000019.10 | 19 | 53985063 | + | CACNG8 | NNNCTGTGCGGTGATTGGAG | NGG | 2 | 0.1714 | Tier II |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
No results found.