Construct: sgRNA BRDN0001149005
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- TCGGCATACGGGACACACGC
Original Target:
- Taxon:
- Homo sapiens (human)
- Gene:
- NO_SITE control
- CRISPR Mechanism
- CRISPRko
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
No results found.
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000073.6 | 7 | 28809088 | + | Hnrnpl | NNNGCATACGGGACCCGCGC | NGG | 2 | 0.0481 | Tier II |
| 2 | NC_000080.6 | 14 | 34034456 | - | Gm5460 | NNNGCAGACGGGACACACGG | NGG | 2 | 0.0346 | Tier II |
| 3 | NC_000086.7 | X | 170010858 | + | Erdr1 | NNNGCACACAGGACACACGC | NGG | 2 | 0.6417 | Tier III |
| 4 | NC_000087.7 | Y | 90785774 | + | Erdr1 | NNNGCACACAGGACACACGC | NGG | 2 | 0.6417 | Tier III |
| 5 | NC_000087.7 | Y | 90793472 | + | Erdr1 | NNNGCACACAGGACACACGC | NGG | 2 | 0.6417 | Tier III |
