Construct: sgRNA BRDN0001149274
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- TCTAACCCAATGCTGTATCG
Original Target:
- Taxon:
-
Homo sapiens (human)
- Gene:
- BMPR1B (658)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Vector Information:
- Vector Backbone:
- pXPR_003
- Pol II Cassette 1:
- EF1A-PuroR
- Pol II Cassette 2:
- n/a
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Additional Information:
- Addgene ID:
- 77489
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
| 1 |
NC_000004.12 |
4 |
95125011 |
- |
BMPR1B |
NNNAACCCAATGCTGTATCG |
NGG |
0 |
1.0 |
Tier I |
| 2 |
NC_000001.11 |
1 |
204479685 |
- |
PIK3C2B |
NNNAAGCAAATGCTGTATCG |
NGG |
2 |
0.325 |
Tier II |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
| 1 |
NC_000069.6 |
3 |
141863094 |
+ |
Bmpr1b |
NNNAGCCCAATGCTGTACCG |
NGG |
2 |
0.3086 |
Tier I |
| 2 |
NC_000072.6 |
6 |
54844485 |
- |
Znrf2 |
NNNAGCCCAATCCTGTATCG |
NGG |
2 |
0.3812 |
Tier II |
| 3 |
NC_000068.7 |
2 |
22423621 |
+ |
Myo3a |
NNNATCCCAATGCTGTATCT |
NGG |
2 |
0.2545 |
Tier II |
| 4 |
NC_000077.6 |
11 |
72046755 |
- |
Pimreg |
NNNAACCCAATGCTGTCTCC |
NGG |
2 |
0.0756 |
Tier II |
| 5 |
NC_000078.6 |
12 |
41348955 |
- |
Immp2l |
NNNAACCCAATGCTGTATCC |
NGA |
2 |
0.0298 |
Tier II |
Other clones with same target sequence:
(none)
