Construct: sgRNA BRDN0001149414
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- TGTCATGGAGTACGCCAACG
Original Target:
- Taxon:
-
Homo sapiens (human)
- Gene:
- AKT1 (207)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Vector Information:
- Vector Backbone:
- pXPR_003
- Pol II Cassette 1:
- EF1A-PuroR
- Pol II Cassette 2:
- n/a
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Additional Information:
- Addgene ID:
- 75502
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
1 |
NC_000014.9 |
14 |
104773923 |
- |
AKT1 |
NNNCATGGAGTACGCCAACG |
NGG |
0 |
1.0 |
Tier I |
2 |
NC_000019.10 |
19 |
40238916 |
- |
AKT2 |
NNNGATGGAGTATGCCAACG |
NGG |
2 |
0.35 |
Tier I |
3 |
NC_000016.10 |
16 |
85311584 |
- |
GSE1 |
NNNCATGGAGTACCCCAAGG |
NGG |
2 |
0.0536 |
Tier II |
4 |
NC_000018.10 |
18 |
2053989 |
+ |
LOC105371956 |
NNNCATGGACTATGCCAACG |
NGG |
2 |
0.28 |
Tier III |
5 |
NC_000016.10 |
16 |
85311584 |
- |
LOC101928502 |
NNNCATGGAGTACCCCAAGG |
NGG |
2 |
0.0536 |
Tier III |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
| Reference Sequence |
Chromosome |
Cut Position |
Match Strand |
Match Gene |
Match Sequence |
PAM Seq. |
Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. |
CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. |
Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. |
1 |
NC_000078.6 |
12 |
112657678 |
- |
Akt1 |
NNNCATGGAGTATGCCAACG |
NGG |
1 |
0.7 |
Tier I |
2 |
NC_000073.6 |
7 |
27633257 |
+ |
Akt2 |
NNNGATGGAGTATGCCAACG |
NGG |
2 |
0.35 |
Tier I |
3 |
NC_000080.6 |
14 |
73522402 |
+ |
Nudt15 |
NNNCATGGAGTACTCCAACA |
NGG |
2 |
0.25 |
Tier II |
4 |
NC_000077.6 |
11 |
16515233 |
+ |
Akt2-ps |
NNNGATGGAGTATGCCAACG |
NGG |
2 |
0.35 |
Tier III |
Other clones with same target sequence:
(none)