Construct: sgRNA BRDN0001149501
Construct Description:
- Construct Type:
- sgRNA
- Other Identifiers:
- n/a
- DNA Barcode:
- GTCCACCGTGTCGGGCACGT
Original Target:
- Taxon:
- Homo sapiens (human)
- Gene:
- PANK4 (55229)
- Gene Description:
- n/a
- CRISPR Mechanism
- CRISPRko
Gene matches for this target sequence (CRISPRko, PAM=NGG, human):
| Reference Sequence | Chromosome | Cut Position | Match Strand | Match Gene | Match Sequence | PAM Seq. | Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases. | CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016. | Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works. | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | NC_000001.11 | 1 | 2515642 | + | PANK4 | NNNCACCGTGTCGGGCACGT | NGG | 0 | 1.0 | Tier I |
| 2 | NC_000016.10 | 16 | 3674350 | + | TRAP1 | NNNCACCATGTCGGGCACGT | NGA | 2 | 0.0694 | Tier I |
| 3 | NC_000002.12 | 2 | 218429436 | - | VIL1 | NNNCACCGTGTCGGGCACGG | NCG | 2 | 0.0189 | Tier I |
| 4 | NC_000016.10 | 16 | 1073664 | - | SSTR5 | NNNCAGCGGGTCGGGCACGT | NGG | 2 | 0.3095 | Tier II |
| 5 | NC_000009.12 | 9 | 132230095 | + | NTNG2 | NNNCACCGTGCCTGGCACGT | NGG | 2 | 0.2 | Tier II |
| 6 | NC_000014.9 | 14 | 105454817 | + | MTA1 | NNNCACCGTGTTGGCCACGT | NGG | 2 | 0.1469 | Tier II |
| 7 | NC_000017.11 | 17 | 49164711 | + | B4GALNT2 | NNNCACCGTGTTGGGCAGGT | NGG | 2 | 0.0718 | Tier II |
| 8 | NC_000011.10 | 11 | 46729190 | + | F2 | NNNCACCGTGTCGGCCAGGT | NGG | 2 | 0.0364 | Tier II |
| 9 | NC_000016.10 | 16 | 56444392 | - | NUDT21 | NNNCACCGTGTCGGCCAGGT | NGG | 2 | 0.0364 | Tier II |
| 10 | NC_000007.14 | 7 | 159030510 | - | VIPR2 | NNNCACCGTGTCGGGCAGGT | NAG | 2 | 0.0346 | Tier II |
| 11 | NC_000017.11 | 17 | 50837076 | + | WFIKKN2 | NNNCACCGTGCCGGGCACGT | NGT | 2 | 0.0108 | Tier II |
| 12 | NC_000016.10 | 16 | 1073664 | - | SSTR5-AS1 | NNNCAGCGGGTCGGGCACGT | NGG | 2 | 0.3095 | Tier III |
Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):
No results found.