GPP Web Portal - Clone Details

Construct: sgRNA BRDN0001162510

Construct Description:

Construct Type:: sgRNA
Other Identifiers:: n/a
DNA Barcode:: ACCACGAGCTCAACCCCATG

Original Target:

Taxon:: Homo sapiens (human)
Gene:: STK10 (6793)
Gene Description:: n/a
CRISPR Mechanism: CRISPRko

Vector Information:

Vector Backbone:: pXPR_003
Pol II Cassette 1:: EF1A-PuroR
Pol II Cassette 2:: n/a
Selection Marker:: PuroR
Visible Reporter:: n/a
Epitope Tag:: n/a

Additional Information:

Addgene ID:: 75489

Gene matches for this target sequence (CRISPRko, PAM=NGG, human):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000005.10	5	172106682	-	STK10	NNNACGAGCTCAACCCCATG	NGG	0	1.0	Tier I
2	NC_000015.10	15	42144107	-	PLA2G4F	NNNACCAGCTCACCCCCATG	NGG	2	0.1435	Tier I
3	NC_000002.12	2	142949514	+	KYNU	NNNACAAGCTCAACACCATG	NGG	2	0.2222	Tier II
4	NC_000004.12	4	69739408	+	SULT1B1	NNNACAAGCTCAACACCATG	NGG	2	0.2222	Tier II
5	NC_000006.12	6	124272425	-	NKAIN2	NNNACAAGCTCAACACCATG	NGG	2	0.2222	Tier II
6	NC_000013.11	13	96198099	+	HS6ST3	NNNACAAGCTCAACACCATG	NGG	2	0.2222	Tier II
7	NC_000014.9	14	31857170	+	NUBPL	NNNACAAGCTCAACACCATG	NGG	2	0.2222	Tier II
8	NC_000003.12	3	12803937	+	CAND2	NNNATGAGCTTAACCCCATG	NGG	2	0.1958	Tier II
9	NC_000011.10	11	17875974	+	SERGEF	NNNAGGAGCTCAACCCCATG	NGA	2	0.0417	Tier II
10	NC_000003.12	3	135406376	+	LOC105374122	NNNACAAGCTCAACCCCACG	NGG	2	0.2759	Tier III
11	NC_000005.10	5	38786764	-	OSMR-DT	NNNACAAGCTCAACACCATG	NGG	2	0.2222	Tier III
12	NC_000005.10	5	38786764	-	LOC107986414	NNNACAAGCTCAACACCATG	NGG	2	0.2222	Tier III
13	NC_000011.10	11	22128827	+	LOC124902645	NNNACAAGCTCAACACCATG	NGG	2	0.2222	Tier III
14	NC_000009.12	9	16240723	+	LINC03041	NNNACGAGCTCTGCCCCATG	NGG	2	0.2174	Tier III
15	NC_000005.10	5	103790508	+	LOC105379107	NNNACGGGCTCAACACCATG	NGG	2	0.1569	Tier III
16	NC_000002.12	2	194754324	+	LINC01790	NNNTCGAGCTCAAGCCCATG	NGG	2	0.0	Tier III
17	NC_000002.12	2	194754324	+	LOC105376755	NNNTCGAGCTCAAGCCCATG	NGG	2	0.0	Tier III

Download CSV

Gene matches for this target sequence (CRISPRko, PAM=NGG, mouse):

	Reference Sequence	Chromosome	Cut Position	Match Strand	Match Gene	Match Sequence	PAM Seq.	Mismatches[?]Genomic matches are found by querying with a reduced sequence corresponding to the final 17mer of the 20mer guide target sequence, combined with the `GG` of the PAM sequence. Mismatches are assessed within this set of bases only, for a total of 19 possible matching bases.	CFD Score[?]Off target matches are assesed via a Cutting Frequency Determination, or CFD score. This value provides an estimate of how specific mismatches affect the likelihood that an sgRNA will cut a given target sequence. For more information, see Doench, Fusi et al., Nature Biotechnology 2016.	Match Tier[?]For a description of CRISPR match tiers, see How the sgRNA Designer Works.
1	NC_000077.6	11	32588889	+	Stk10	NNNACGAGCTCAACCCCATG	NGG	0	1.0	Tier I
2	NC_000075.6	9	49534919	+	Ncam1	NNNACGAGCACAATCCCATG	NGG	2	0.6286	Tier II
3	NC_000075.6	9	49534919	+	Gm11149	NNNACGAGCACAATCCCATG	NGG	2	0.6286	Tier III
4	NC_000069.6	3	149416585	+	Gm30382	NNNACGAGCTTAACTCCATG	NGG	2	0.0205	Tier III

Download CSV

Other clones with same target sequence:

(none)