Construct: shRNA TRCN0000034078  
  
    Construct Description:
    
      - Construct Type:
  - shRNA
 
      - Other Identifiers:
  - NM_057178.2-1232s1c1
 
                    - DNA Barcode:
  - GCAGTATGTAATCCGAGCTGT
 
             
       
    
          Original Target:
        
          - Taxon:
  - 
                          Homo sapiens (human)                      
 
                      - Gene:
  - RFFL (117584)
 
            - Gene Description:
  - ring finger and FYVE like domain containing E3 ubiquitin protein ligase
 
                          - Transcript:
  - RefSeq NM_057178.2 (NON-CURRENT)
 
              - Match location:
  - Position 1232 (CDS)
 
                                        
 
       
  
    Vector Information:
    
      - Vector Backbone:
  - pLKO.1
 
      - Pol II Cassette 1:
 - PGK-PuroR
 - Pol II Cassette 2:
 - n/a
 - Pol III Promoter:
 - constitutive hU6
 - Pol III Insert:
 - (TRCN0000034078)
 - Selection Marker:
 - PuroR
 - Visible Reporter:
 - n/a
     
       
 
  Current transcripts matched by this shRNA:
  
  
      Sequence Information
    
      - Target Sequence:
  - GCAGTATGTAATCCGAGCTGT
 
      - Hairpin Sequence:
  - 
        5'-CCGG-GCAGTATGTAATCCGAGCTGT-CTCGAG-ACAGCTCGGATTACATACTGC-TTTTTG-3'
 
    
    Oligo design for arrayed cloning:
    
      - Forward sequence:
  - 5'-CCGGGCAGTATGTAATCCGAGCTGTCTCGAGACAGCTCGGATTACATACTGCTTTTTG-3'
 
      - Reverse sequence:
  - 5'-AATTCAAAAAGCAGTATGTAATCCGAGCTGTCTCGAGACAGCTCGGATTACATACTGC-3'
 
    
    Other clones with same target sequence:
    (none)