Construct: shRNA TRCN0000074755

Construct Description:

Construct Type:
shRNA
Other Identifiers:
NM_001009.2-543s1c1
DNA Barcode:
CGGAACATTAAGACCATTGCT

Original Target:

Taxon:
Homo sapiens (human)
Gene:
RPS5 (6193)
Gene Description:
ribosomal protein S5
Transcript:
RefSeq NM_001009.2 (NON-CURRENT)
Match location:
Position 543 (CDS)
CRISPR Mechanism
CRISPR

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000074755)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this shRNA:

Sequence Information

Target Sequence:
CGGAACATTAAGACCATTGCT
Hairpin Sequence:
5'-CCGG-CGGAACATTAAGACCATTGCT-CTCGAG-AGCAATGGTCTTAATGTTCCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGGAACATTAAGACCATTGCTCTCGAGAGCAATGGTCTTAATGTTCCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGGAACATTAAGACCATTGCTCTCGAGAGCAATGGTCTTAATGTTCCG-3'

Other clones with same target sequence:

(none)